ID: 1166965229

View in Genome Browser
Species Human (GRCh38)
Location 19:46525879-46525901
Sequence CTGGACACACAGATTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166965219_1166965229 29 Left 1166965219 19:46525827-46525849 CCACTGTAAGGGGGAAGGGGGTC 0: 1
1: 0
2: 2
3: 14
4: 106
Right 1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG 0: 1
1: 0
2: 5
3: 26
4: 315
1166965225_1166965229 1 Left 1166965225 19:46525855-46525877 CCCAGGGATGAGGTGGACCTGGC 0: 1
1: 0
2: 1
3: 31
4: 222
Right 1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG 0: 1
1: 0
2: 5
3: 26
4: 315
1166965226_1166965229 0 Left 1166965226 19:46525856-46525878 CCAGGGATGAGGTGGACCTGGCT 0: 1
1: 0
2: 1
3: 17
4: 259
Right 1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG 0: 1
1: 0
2: 5
3: 26
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166965229 Original CRISPR CTGGACACACAGATTGAGAG AGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900583260 1:3419676-3419698 CTGGCCACACAGAGCTAGAGGGG + Intronic
900819887 1:4878526-4878548 GTGCCCACCCAGATTGAGAGTGG - Intergenic
901243883 1:7713124-7713146 CTGACCACACAGAGTGAGTGAGG + Intronic
902195456 1:14794835-14794857 GTGCCCACACAGATTGAGGGTGG - Intronic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
906106719 1:43298952-43298974 CTGCACACACAAATTTTGAGTGG - Intergenic
906578524 1:46913832-46913854 CTGCCCACCCAGATTGAGAATGG + Intergenic
906609934 1:47194435-47194457 CTTGCCCCACAGATAGAGAGTGG - Intergenic
907735378 1:57106819-57106841 CAAGACTCACAGATTGATAGAGG + Intronic
907827980 1:58037197-58037219 CTGCACACACAGATTTCTAGAGG + Intronic
908326343 1:63027615-63027637 GTGGACACCCAGATTGAGGGTGG - Intergenic
908650187 1:66324322-66324344 AAGGACAGAGAGATTGAGAGGGG - Intronic
909388585 1:75090549-75090571 CTGTCCACACAGATTTAAAGAGG + Intergenic
910273642 1:85424215-85424237 CTGGCCACACAGAATGAGTTAGG + Intronic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911763482 1:101643970-101643992 GTGCCCACCCAGATTGAGAGTGG - Intergenic
912282176 1:108327549-108327571 CAGGACACACAGAGTGGCAGTGG + Intergenic
912812265 1:112803242-112803264 CAGGAAACCCAGATTGTGAGGGG - Intergenic
913176983 1:116283075-116283097 CTGGCCTCATAGAATGAGAGAGG + Intergenic
913432552 1:118811288-118811310 TTGGTCACACAGATTCAAAGTGG + Intergenic
913533677 1:119751063-119751085 CTGGACCCACAGAACAAGAGGGG + Intronic
913969284 1:143402258-143402280 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914063661 1:144227857-144227879 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914115489 1:144738497-144738519 CTGGACAAGCAGATTGTGAAGGG - Intergenic
914256176 1:145962390-145962412 CTGGGCACACAGCCTGGGAGGGG - Intronic
915378082 1:155415582-155415604 CTTGACACAAAGTTTGAGGGAGG + Intronic
915940265 1:160114396-160114418 CTGGGCACAGAGATGGAGTGAGG - Intergenic
918605680 1:186422928-186422950 CGGGACACAAAGATTGAAAAAGG + Intergenic
918666438 1:187156487-187156509 CTGGACTCACAGAATGAGTTAGG + Intergenic
919326979 1:196120463-196120485 CTGAACAAACAGAATGAAAGAGG + Intergenic
919674427 1:200367324-200367346 TTGGAAATACAGATTGAAAGAGG + Intergenic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920760916 1:208783073-208783095 CTGTACACACAGAGTAAAAGAGG - Intergenic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
920998741 1:211020627-211020649 CTGGACTCATAGATTGAGTTTGG - Intronic
923669317 1:236026498-236026520 GTGGCCACACAGCTTGTGAGTGG - Intronic
923705858 1:236344291-236344313 CTGGACCCAAAGATTTGGAGAGG - Intergenic
1063233638 10:4090204-4090226 CTGGATACCCAGGTTGAGAGAGG + Intergenic
1066167494 10:32802913-32802935 GTGCCCACCCAGATTGAGAGTGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067787691 10:49262617-49262639 CTGGCCACACAGATGGGGTGAGG + Intergenic
1067788350 10:49269565-49269587 CTGGACATACAGATAGGCAGTGG - Intergenic
1068238043 10:54263868-54263890 GTGCCCACCCAGATTGAGAGTGG - Intronic
1068504117 10:57877680-57877702 GTGGCCACGCAGATTGAGGGTGG - Intergenic
1069266643 10:66466533-66466555 CTGGACACAATGAGTGAGGGGGG - Intronic
1070177392 10:73983453-73983475 CTGTACACATATATAGAGAGAGG - Intergenic
1071804733 10:89105640-89105662 CTGCCCACCCAGATTGAGCGTGG + Intergenic
1071981947 10:91012351-91012373 CAGGACAGACAGATTGAAGGAGG - Intergenic
1072070406 10:91909590-91909612 CTGGAGAGACAGAGAGAGAGAGG - Intergenic
1072302686 10:94076786-94076808 CTGGACACCCACCTTGAGGGGGG + Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1073348841 10:102804618-102804640 ATGGACACACAGTGTGAGTGAGG - Intronic
1074080413 10:110164078-110164100 CTGGACCCAGAGAATGACAGAGG + Intergenic
1078558086 11:12347074-12347096 GTGGAGACAGAGATTGGGAGGGG - Intronic
1079401724 11:20111335-20111357 CTGGACAGACAGACACAGAGGGG - Intronic
1080298515 11:30757776-30757798 CTGGTCACACAGCTAGAAAGTGG + Intergenic
1080799802 11:35599649-35599671 CAGAACCCACAGATAGAGAGGGG - Intergenic
1081323786 11:41721426-41721448 CTAGACACACAGAGTAAAAGAGG + Intergenic
1081756065 11:45545395-45545417 CCAGAGACACAGATTGGGAGAGG + Intergenic
1082085966 11:48049794-48049816 GTGGGCAGACAGATTGACAGTGG + Intronic
1083728374 11:64640236-64640258 CTGGACAGAGGGATTGAAAGTGG - Intronic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1084535386 11:69753319-69753341 CTGGCCACAGAGCCTGAGAGGGG + Intergenic
1084537032 11:69763364-69763386 CTGGACACACAGACACACAGAGG + Intergenic
1084590439 11:70086927-70086949 CTGGACACACAGCTAGTTAGTGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1085963143 11:81487518-81487540 CTGGAAACAGAGAGAGAGAGAGG + Intergenic
1086906245 11:92421423-92421445 CTGCACAAACAGACTGAAAGAGG - Intronic
1087657975 11:100949250-100949272 CTGGTAACACAGTTTGAGGGAGG - Intronic
1087846938 11:102984081-102984103 CTGGAGACAAAACTTGAGAGTGG + Intergenic
1088448897 11:109961665-109961687 GTGACCACCCAGATTGAGAGTGG - Intergenic
1089156340 11:116405831-116405853 CTGGACCCCCATAATGAGAGAGG + Intergenic
1089843026 11:121435215-121435237 ATGGAGAGAGAGATTGAGAGAGG - Intergenic
1092043679 12:5408659-5408681 CTTGACAAACAGATAGTGAGGGG - Intergenic
1092317939 12:7439774-7439796 CTGGACATAAAGATCGAGGGGGG - Intronic
1092370134 12:7909994-7910016 GTGCCCACACAGATTGAGGGTGG - Intergenic
1093284939 12:17247462-17247484 CTCCACACCCAGATTCAGAGGGG + Intergenic
1095783219 12:46083709-46083731 CTGGCCAAACAGATTATGAGAGG + Intergenic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096977067 12:55705524-55705546 AGGGCCACCCAGATTGAGAGGGG - Intronic
1097701830 12:62828180-62828202 CTGGACACACTGGTTAAAAGAGG - Intronic
1098215559 12:68213381-68213403 CTGGACTCACAGAATGAGTTTGG + Intronic
1098450838 12:70616652-70616674 CAGGACATGCTGATTGAGAGGGG - Intronic
1099493501 12:83315526-83315548 GTGCCCACACAGATTAAGAGTGG - Intergenic
1101192662 12:102351202-102351224 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1101786626 12:107889718-107889740 CTGGACACTGAGTTTGAGAAAGG + Intergenic
1101913969 12:108882138-108882160 CTGGACACCCAGGTGGTGAGAGG - Intronic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1106443534 13:29801830-29801852 CCGAACACACTGATTGATAGAGG + Intronic
1106611068 13:31281343-31281365 CTGAACAAACTGATTGAAAGGGG + Intronic
1106777800 13:33025459-33025481 CTGGGCACACAAAGTGAGAAGGG + Intronic
1106945303 13:34820866-34820888 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1109072808 13:57789870-57789892 CTGGACACAGACATTTACAGAGG - Intergenic
1110948109 13:81450054-81450076 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1112158240 13:96840835-96840857 GTGCACACACAGAGTGAAAGAGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113096236 13:106666922-106666944 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1113140739 13:107146484-107146506 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1113719816 13:112546703-112546725 CTGGACACAGAAAGTGACAGAGG + Intronic
1113789780 13:113022193-113022215 GTGGACACAGAGGTGGAGAGTGG - Intronic
1115276087 14:31610550-31610572 CTGGCCTCACAGAATGAGTGTGG - Intronic
1115435094 14:33363054-33363076 GTGGACACACATAATGAAAGGGG - Intronic
1116754508 14:48929259-48929281 GTGCCAACACAGATTGAGAGTGG - Intergenic
1118440264 14:65805723-65805745 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1118449697 14:65888850-65888872 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119132302 14:72185217-72185239 GTGCCCACCCAGATTGAGAGTGG + Intronic
1121909253 14:97774338-97774360 CTAAACACACAGACTGAGACAGG + Intergenic
1123124291 14:105934576-105934598 CTGGACTCACAGAATGAGTTGGG - Intergenic
1124955982 15:34360570-34360592 CTGGTCCAACAGATTGAAAGGGG + Intronic
1126256780 15:46636618-46636640 CTGGACACCCAGGATGAGACTGG - Intergenic
1128576884 15:68782398-68782420 GGGGACACACAGCTTGCGAGTGG + Intronic
1129174050 15:73827124-73827146 CTGGACAGACAGAGTGGCAGAGG + Intergenic
1130542284 15:84829103-84829125 CTGGGAAGACAAATTGAGAGGGG - Intronic
1131570962 15:93535597-93535619 CTGGACACACAGGTCTTGAGGGG - Intergenic
1131578822 15:93620026-93620048 ACGGAGACAGAGATTGAGAGAGG + Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1135898462 16:26432274-26432296 CTGGAGAGAGAGATTGAGATCGG - Intergenic
1138211965 16:55171015-55171037 CTGTTCTAACAGATTGAGAGAGG + Intergenic
1139269701 16:65670710-65670732 CTGGACACACAGAATGTTTGTGG + Intergenic
1139312327 16:66038070-66038092 CTGCCCACCCAGATTGAGGGTGG + Intergenic
1140164185 16:72531821-72531843 TTGGACGCACAGATAGAGAACGG - Intergenic
1140221016 16:73044006-73044028 CAGGCCACTCAGATTGAGAAAGG - Intronic
1140675671 16:77326879-77326901 ATGGACCCAAAGATTGAGAGTGG - Intronic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1145840352 17:27989197-27989219 CTGGGCCCAAAGATTCAGAGGGG + Intergenic
1147422969 17:40331709-40331731 CTGGACACACAGGTTGGAGGTGG + Intronic
1147425912 17:40345772-40345794 CTGCACACACAGGTGGAGTGGGG - Intronic
1148960452 17:51388191-51388213 GTGGCCACCCAGATTGAGGGTGG + Intergenic
1149123921 17:53204741-53204763 GTGGCCACCCAGATTGAGGGTGG - Intergenic
1149207852 17:54268945-54268967 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1150220846 17:63495221-63495243 CGGGGCACACAGAAGGAGAGGGG - Intronic
1151086193 17:71383971-71383993 TTGGACACACATATCGACAGGGG + Intergenic
1151540234 17:74761055-74761077 CTGGACACACAGTATGATGGAGG - Intronic
1152139565 17:78528563-78528585 CTGGACACAGAGAAGGGGAGAGG + Intronic
1155618240 18:27746049-27746071 GTGCACACCCAGATTGAGGGTGG - Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1158113029 18:53962945-53962967 CAGGAGACAGGGATTGAGAGCGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160427877 18:78790708-78790730 GTGGACACACAGATGGGGAGCGG + Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165067561 19:33237862-33237884 CTGGACCCTCAGCTTGAGCGAGG - Intergenic
1165264145 19:34646490-34646512 CTGGACAAACACAGTGAGTGTGG - Intronic
1166374667 19:42320949-42320971 CAGGACACAAAGTTGGAGAGGGG - Intronic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1166942701 19:46376337-46376359 GTGGACACACAGGTCGAGAGCGG - Intronic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
925576522 2:5366335-5366357 TTCGACACAGAGATTGAGGGAGG + Intergenic
926283688 2:11470643-11470665 GTGCCCACCCAGATTGAGAGTGG + Intergenic
926399769 2:12485514-12485536 CTGGCCAACCAGATTCAGAGGGG - Intergenic
926719362 2:15948011-15948033 CTGGACACACAGTTTGTCAGGGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927152610 2:20204479-20204501 CTGGACACACACAATGGGAAGGG - Intronic
927232827 2:20842294-20842316 CTGGCCACACAAATAGAGTGTGG - Intergenic
927621392 2:24663827-24663849 CAGGACACGCAGACAGAGAGGGG - Intronic
930020649 2:46999983-47000005 CAGGCCACACAGATTGTGAATGG - Intronic
931103336 2:59027376-59027398 CTGAACACACAGGCTGTGAGGGG - Intergenic
934173977 2:89563159-89563181 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934284292 2:91637508-91637530 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934545068 2:95207647-95207669 CCGGACACTCAGATTAAAAGGGG - Exonic
934615840 2:95770192-95770214 CTGGACACACAGATCGGCAGGGG + Intergenic
934645055 2:96054366-96054388 CTGGACACACAGATCAGCAGGGG - Intergenic
934838462 2:97610455-97610477 CTGGACACACAGATCAGCAGGGG - Intergenic
935491183 2:103722372-103722394 ATGGCCACCCAGATTGAGGGTGG - Intergenic
936667464 2:114613371-114613393 CAGGACACAAAATTTGAGAGGGG + Intronic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
940015091 2:149095910-149095932 ATGCACACACAGACAGAGAGAGG + Intronic
940642999 2:156366818-156366840 CAGGATGCACAGAGTGAGAGAGG + Intergenic
941283120 2:163577678-163577700 GTGCCCACCCAGATTGAGAGTGG - Intergenic
941547323 2:166868252-166868274 CTGGCCACACAGCAGGAGAGCGG + Intergenic
943170062 2:184386504-184386526 GTGCCCACCCAGATTGAGAGTGG - Intergenic
946206876 2:218115938-218115960 CATGGCACACAGACTGAGAGGGG - Intergenic
946669546 2:222088205-222088227 ATGCACACACAGATTGAGAGAGG - Intergenic
947019404 2:225657905-225657927 TTGGTCACACAGAGTGAGGGTGG - Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948657615 2:239486483-239486505 CTGGACCCACAGGTGCAGAGTGG - Intergenic
948881934 2:240863240-240863262 CGTGACACACAGATTGAGTCAGG - Intergenic
949002605 2:241625127-241625149 CTGGACACACAGAATGAGTTAGG - Intronic
1173951653 20:46998182-46998204 CTGGACAGACACACTGAGGGTGG - Intronic
1174060813 20:47831630-47831652 CTGGACACACAGACAGAGAGGGG - Intergenic
1174071085 20:47899740-47899762 CTGGACACACAGACAGAGAGGGG + Intergenic
1174100018 20:48120044-48120066 CTGGACACACAGACAGGGAGGGG - Intergenic
1174152967 20:48498922-48498944 CTGGACACACAGACAGGGAGGGG - Intergenic
1174851421 20:53998971-53998993 AAGGTCACACAGCTTGAGAGAGG + Intronic
1175326257 20:58130382-58130404 CAGGACACTCAGACTCAGAGAGG - Intergenic
1176070552 20:63224096-63224118 CTCCACACGCAGAGTGAGAGGGG - Intergenic
1176787974 21:13281874-13281896 CTGGACACAGAGAAAGAGATGGG + Intergenic
1177452560 21:21290346-21290368 CTGAACACACACTTTAAGAGAGG + Intronic
1177478783 21:21659236-21659258 ATGCCCACCCAGATTGAGAGTGG + Intergenic
1177514785 21:22135197-22135219 GTGGCCACCCAGATTGAGGGTGG - Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1181436900 22:22916432-22916454 ATGGACAAACACCTTGAGAGAGG - Intergenic
1182150434 22:28023555-28023577 TTGGACCCACAAATTGAAAGTGG - Intronic
1182155134 22:28064380-28064402 TTGGAAACACAGAATCAGAGAGG - Intronic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1183004744 22:34891774-34891796 ATGGGCACACAGACTGAGGGTGG - Intergenic
1183714313 22:39524756-39524778 CTTGGCAGACAGATGGAGAGAGG - Intergenic
1183739363 22:39661617-39661639 CTGGTCACACAGCTTGGAAGTGG - Intronic
1184867846 22:47212156-47212178 GTGGACACACATATTTAGTGTGG - Intergenic
1185168344 22:49276169-49276191 CTGCACTGGCAGATTGAGAGTGG + Intergenic
1185224080 22:49643239-49643261 CTGGACACACAGTTTGACCCAGG + Intronic
951944020 3:28114054-28114076 CTGAAAACACAGGTTCAGAGAGG - Intergenic
953903968 3:46858943-46858965 ATGCACACACAGAGAGAGAGAGG + Intronic
956216273 3:66852626-66852648 GTGCCCACACAGATTGAGAGTGG + Intergenic
957483460 3:80828312-80828334 GTGCCCACACACATTGAGAGTGG - Intergenic
959236775 3:103733531-103733553 TTGGACACAGACATAGAGAGAGG - Intergenic
959868780 3:111302816-111302838 GTGCCCACACAGACTGAGAGTGG + Intronic
960296518 3:115951581-115951603 GTGGCCACCCAGATTGAGGGTGG - Intronic
960607558 3:119523207-119523229 CTGGTCACAGAGTTTAAGAGTGG + Intronic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
962014772 3:131428547-131428569 TTGGACACACAGAGAGACAGTGG + Intergenic
964202620 3:154135086-154135108 CTGGCCTCATAGAATGAGAGAGG + Intronic
964384159 3:156129549-156129571 CAGGTCACACAGATTGTAAGGGG - Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965858765 3:173121327-173121349 CTGAAAACACACATTGAGCGAGG - Intronic
965951037 3:174308534-174308556 GTGCCCACACAGATTGAGGGTGG + Intergenic
967279307 3:187806658-187806680 CAGGACACACAGAATGAGAGTGG - Intergenic
967776647 3:193392545-193392567 GTGGCCACACAGACTGTGAGAGG - Intergenic
968847253 4:3051615-3051637 TTGAACACACAGAGAGAGAGAGG - Intergenic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969827823 4:9771975-9771997 CTGGACAAGCAGATTGTGAAGGG + Intronic
970329235 4:14962224-14962246 GTGCCCACACAGATTGAGAGTGG + Intergenic
971559867 4:28064448-28064470 GATGATACACAGATTGAGAGTGG - Intergenic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
973035055 4:45396123-45396145 CTTGATTCTCAGATTGAGAGTGG + Intergenic
973035742 4:45403886-45403908 GTGTCCACCCAGATTGAGAGTGG + Intergenic
974479478 4:62424548-62424570 TTGCCCACCCAGATTGAGAGTGG + Intergenic
974832567 4:67207483-67207505 CTGGACATACAGATTTGGAAGGG - Intergenic
977560532 4:98528995-98529017 AAGGTCACACAGATTGACAGTGG + Intronic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
980482693 4:133408630-133408652 CTGACCACCCAGATTGAGGGTGG - Intergenic
981199010 4:141956505-141956527 CTGCCCACACAGATGGACAGAGG + Intergenic
981321257 4:143394395-143394417 TTGGACACACAGATTAACTGAGG - Intronic
982839298 4:160161865-160161887 GTGGCCACCCAGATTGAGGGCGG + Intergenic
983773717 4:171580700-171580722 ATGGACAAACAGATTAAGATTGG - Intergenic
984732814 4:183084231-183084253 GTGCACACTCAGATTGAGGGTGG - Intergenic
985188419 4:187344555-187344577 ATGATCACACAAATTGAGAGTGG - Intergenic
986489561 5:8275124-8275146 CTTGCCACACAGACTGAGGGGGG + Intergenic
986585133 5:9308553-9308575 CTGGAAACACAGTCTGAGATAGG - Intronic
987994031 5:25251687-25251709 GTGCCCACACAGATTGAGGGTGG - Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
990780011 5:59349937-59349959 CTAGAAACAGAGATAGAGAGGGG - Intronic
991654837 5:68893738-68893760 CTGACCACACAGATTGAGTGAGG - Intergenic
992096165 5:73364989-73365011 CTGGACACCCTCATTCAGAGAGG + Intergenic
992752389 5:79873359-79873381 CTGTACACAGAGCATGAGAGTGG + Intergenic
993193796 5:84713691-84713713 CTTGAAACAAAGATTGAGACTGG - Intergenic
995196343 5:109373346-109373368 CTAGAGGCACAGAATGAGAGGGG + Intronic
995647493 5:114329347-114329369 ATGCCCACACAGATTGAGGGTGG - Intergenic
998176872 5:139906775-139906797 GTTGACACACAGCTTGACAGAGG + Intronic
999170085 5:149586589-149586611 CTGGATACACAGCATCAGAGTGG - Intronic
999304115 5:150508779-150508801 CCAGACACACAAATTCAGAGTGG - Intronic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1001759737 5:174197462-174197484 CTGGACACAGAGACAGACAGAGG + Intronic
1002254946 5:177951718-177951740 CTTCCCACACAGGTTGAGAGAGG + Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003691797 6:8362129-8362151 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1003823726 6:9928882-9928904 CTGGACTCACAGAATGAGTTAGG - Intronic
1004257081 6:14074294-14074316 CAGGAGAGACAGATTGTGAGAGG - Intergenic
1004276276 6:14238128-14238150 CTCCACACACAGATGAAGAGGGG - Intergenic
1006088557 6:31614375-31614397 CTGGCCAAACAGAGTGACAGAGG + Intergenic
1007158636 6:39770880-39770902 CTGAACATAGAAATTGAGAGTGG - Intergenic
1009660776 6:66607583-66607605 CTGCCCACCCAGATTGAGAGTGG + Intergenic
1009946398 6:70346802-70346824 CTGATCACACCGATTGATAGTGG - Intergenic
1011186569 6:84683361-84683383 GTGCCCACACAGATTGAGAGTGG - Intergenic
1011489949 6:87881266-87881288 CTGAAGCCACAGATTCAGAGTGG + Intergenic
1011696932 6:89921359-89921381 CTGGGCACACTGCTTGAGGGAGG + Intergenic
1013823315 6:114181230-114181252 CGGGTCACACAGATAGAAAGAGG - Intronic
1014066484 6:117132876-117132898 GTGCCCACACAGATTAAGAGTGG + Intergenic
1014083203 6:117312099-117312121 ACGGAAGCACAGATTGAGAGAGG - Intronic
1014328928 6:120035516-120035538 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1014386595 6:120810457-120810479 CTGGACTCATAGAATGAGATAGG - Intergenic
1018298602 6:162376690-162376712 ATGGACACACGGAGAGAGAGGGG + Intronic
1018972819 6:168540344-168540366 CTGGACACGCAGCTGGGGAGAGG - Intronic
1019493098 7:1324144-1324166 CGAGTCACACTGATTGAGAGGGG + Intergenic
1019773965 7:2901419-2901441 CTGTACACACACATTCACAGCGG - Intergenic
1020735689 7:11946525-11946547 CTGGCCACACAGAATGAGTTAGG + Intergenic
1021433610 7:20589074-20589096 CCGGACACATAGAGTCAGAGCGG - Intergenic
1023463704 7:40429688-40429710 GTGCACACCCAGATTGAGGGTGG + Intronic
1024700796 7:51902040-51902062 CTGGACTCACAGCTGGGGAGGGG + Intergenic
1025234122 7:57222382-57222404 CTGGACACACAGACAGGGAGGGG + Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1028439023 7:90837761-90837783 GTGGGCAGACAGATTCAGAGGGG + Intronic
1028688934 7:93627494-93627516 GTGCCCACCCAGATTGAGAGTGG - Intronic
1029612163 7:101632370-101632392 CTGCCCACACAGATTAAGGGTGG + Intergenic
1029732595 7:102447839-102447861 CTGGCCACACGGACTCAGAGGGG + Exonic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031176747 7:118362211-118362233 GTGCCCACACAGATTGAGGGTGG - Intergenic
1034066804 7:148144794-148144816 CTGGAGACACACATTAAGCGAGG + Intronic
1034170336 7:149058002-149058024 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1035060004 7:156062213-156062235 CTGGCCACACAGAGTGGGAAGGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036491392 8:9229329-9229351 CTGCCCACCCAGATTGAGGGTGG + Intergenic
1037186139 8:16065738-16065760 GTGGCCACTCAGATTGAGGGTGG - Intergenic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1039177339 8:34824824-34824846 CTGCACACATAAATTGACAGAGG + Intergenic
1039599826 8:38826625-38826647 ATGGAAATACAGATTTAGAGAGG + Intronic
1039745035 8:40417463-40417485 GTGACCACACAGATTGAGGGTGG + Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1042751940 8:72167185-72167207 CTGGTCACACAGAATGAGTTAGG + Intergenic
1044147871 8:88740292-88740314 GTGTCCACTCAGATTGAGAGTGG - Intergenic
1044784324 8:95778540-95778562 TGGGACATACAGATTGAGAAAGG - Intergenic
1046500751 8:115073158-115073180 GTGCCCACACAGATTGAGGGTGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047019563 8:120760525-120760547 CTGGAGACCCAGCCTGAGAGAGG + Intronic
1047739879 8:127797910-127797932 CAGGTCACACAGCTTGGGAGAGG + Intergenic
1047761835 8:127960279-127960301 CAGGTCACACAGCTTGAGGGTGG + Intergenic
1051149424 9:14064263-14064285 CAGGACACACAAAAAGAGAGGGG - Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054144802 9:61554395-61554417 CTGGACACGCAGGTGCAGAGAGG + Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054855911 9:69899507-69899529 CTGCACACACAGGATGGGAGAGG - Intronic
1055882952 9:81023864-81023886 GTGGCCACCCACATTGAGAGTGG - Intergenic
1055968409 9:81887906-81887928 CTAGAAACAGAGATTGAGATAGG + Intergenic
1059234957 9:112753055-112753077 TTGGTCACACAGATTGACACTGG + Intronic
1059562156 9:115346332-115346354 ATGGCCACTCAGATTGAGGGTGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060841717 9:126798880-126798902 CAGCACAAACAGACTGAGAGAGG - Intergenic
1060967082 9:127717410-127717432 CTGGACCCACAGCTGGTGAGAGG + Exonic
1062161119 9:135080460-135080482 CTGGACACACGGAGGGAGAGGGG + Intronic
1186116351 X:6308623-6308645 GTGTCCACACAGATTGAGGGTGG - Intergenic
1187406058 X:19005066-19005088 AAGGACACACAGATAGAAAGTGG + Intronic
1189116518 X:38348783-38348805 CTGAACACAGAGATGAAGAGAGG - Intronic
1190545600 X:51523176-51523198 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1191226134 X:58045049-58045071 GTGTCCACACAGATTGAGGGTGG - Intergenic
1191826164 X:65366460-65366482 CTAGACAGACAGAAAGAGAGAGG - Intergenic
1191967662 X:66777743-66777765 GAGGACACAAAGATTCAGAGAGG + Intergenic
1192661279 X:73045304-73045326 GTGTCCACCCAGATTGAGAGTGG + Intergenic
1192996479 X:76518089-76518111 CTGCCCACCCAGATTGAGGGTGG - Intergenic
1193479258 X:82007237-82007259 CTGGACTCACAGAATGAGTTGGG + Intergenic
1194230320 X:91314571-91314593 GTGCACACCCAGATTGAGGGTGG + Intergenic
1195198291 X:102520209-102520231 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1196230754 X:113218124-113218146 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1196501173 X:116384503-116384525 CTTGATAGAAAGATTGAGAGAGG + Intergenic
1196512280 X:116525728-116525750 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1197912721 X:131501944-131501966 GTGCCCACACAGATTGAGGGTGG + Intergenic
1199255065 X:145710098-145710120 CTTGACAGACAGAGTGAAAGTGG + Intergenic
1199714351 X:150495669-150495691 CTGGGGACACAGAGTCAGAGAGG + Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200305692 X:155024089-155024111 ATGGCCACACAGCTTGTGAGTGG + Intronic
1200884134 Y:8252241-8252263 CTGGACACAGACATGGGGAGTGG - Intergenic