ID: 1166965486

View in Genome Browser
Species Human (GRCh38)
Location 19:46527273-46527295
Sequence CTAAGGTTGATGAAGTGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166965486_1166965488 17 Left 1166965486 19:46527273-46527295 CCGGCACACTTCATCAACCTTAG 0: 1
1: 0
2: 1
3: 17
4: 105
Right 1166965488 19:46527313-46527335 TCAAACACCTTGCCCGTCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 75
1166965486_1166965491 25 Left 1166965486 19:46527273-46527295 CCGGCACACTTCATCAACCTTAG 0: 1
1: 0
2: 1
3: 17
4: 105
Right 1166965491 19:46527321-46527343 CTTGCCCGTCTGAGGACCATGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1166965486_1166965490 24 Left 1166965486 19:46527273-46527295 CCGGCACACTTCATCAACCTTAG 0: 1
1: 0
2: 1
3: 17
4: 105
Right 1166965490 19:46527320-46527342 CCTTGCCCGTCTGAGGACCATGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166965486 Original CRISPR CTAAGGTTGATGAAGTGTGC CGG (reversed) Intronic
902239012 1:15075914-15075936 CAAAGGGTGATGAAGTGCTCTGG - Intronic
903871235 1:26436359-26436381 CCAAGGTGGATGGAGTGTGGTGG - Intronic
903906347 1:26690082-26690104 ATAGGCTTGATGAAGTGTGCTGG + Intergenic
909461340 1:75918348-75918370 CAAAGGTTGAGCAAGTTTGCTGG - Intergenic
909505876 1:76389126-76389148 CTAAGCTTGATTGAGTGTTCAGG + Intronic
909759796 1:79272328-79272350 ATAAGGTTGCTGAAGTTTGCTGG - Intergenic
917613224 1:176711096-176711118 CTAAAGGTGATGAAGTGGCCTGG - Intronic
922037403 1:221862614-221862636 CCAAGGTTTATGAAGTTTGAAGG - Intergenic
922528411 1:226324328-226324350 CTAATGTTAATAAAGTGTGAGGG + Intergenic
922615582 1:226959438-226959460 CTGATGTTGATGAGGTGTGAAGG + Intronic
1066980164 10:42405640-42405662 CTAATTTTGCTGCAGTGTGCTGG - Intergenic
1067999880 10:51320205-51320227 GTAAGGTAGATGAAGTTTCCAGG - Intronic
1074177946 10:111029985-111030007 CTAAGGTGGATGGAGTGGGAAGG + Intergenic
1079449175 11:20584532-20584554 CTCAGGTTGATGTTGTGTGAAGG + Intergenic
1080612006 11:33912690-33912712 TTAAGGTTGATTAAGTGAGTGGG - Intergenic
1083893792 11:65610305-65610327 CTCAGCTTGATGAAGTGTTCAGG - Intronic
1086284594 11:85232038-85232060 CTAAGGTGGGTGAAATTTGCAGG - Intronic
1089045412 11:115497993-115498015 CCAAGGTTCATGAAATGTGAGGG - Intronic
1089145827 11:116329108-116329130 CTAAGGCTCATGAAGAGGGCTGG - Intergenic
1092945247 12:13448256-13448278 TTAATTTTGATGAAGTGTTCAGG - Intergenic
1094330968 12:29292868-29292890 ATAAGGTTGATAAAGTGTCCTGG + Intronic
1099184811 12:79505010-79505032 CTATGGTGGCTGCAGTGTGCTGG - Intergenic
1099193109 12:79581341-79581363 CTAGGGCTGATGAAGTATGCAGG - Intronic
1100837953 12:98585037-98585059 CTAAGGCTGATGAAGTGTCCTGG - Intergenic
1100854633 12:98748287-98748309 CTAAGGGTGAGGAGGTGAGCAGG + Intronic
1101965842 12:109281469-109281491 CTGATGTTGATGAAGTCTACAGG + Exonic
1107461104 13:40603982-40604004 CTGGGGTTGATGTGGTGTGCTGG + Intronic
1107585924 13:41848351-41848373 CTAAGATTAAAGAAATGTGCTGG + Intronic
1109406853 13:61911530-61911552 CTAGTGTTAATGAAGAGTGCAGG + Intergenic
1111478109 13:88781596-88781618 CTAATGTAGATGAACTATGCAGG + Intergenic
1112835575 13:103510202-103510224 CTCTGGTGGACGAAGTGTGCAGG + Intergenic
1113041798 13:106111508-106111530 CTGAGGTTGATGAAGCGAGCTGG + Intergenic
1115535437 14:34368761-34368783 GTAAGGTTGATTGAGTGTGGTGG - Intronic
1116231836 14:42228516-42228538 TCAAGGTGGCTGAAGTGTGCTGG + Intergenic
1117433148 14:55690362-55690384 CTTATGTTGATGAATTGTGTTGG + Intronic
1117956914 14:61130243-61130265 CTGAGGGTGATGAAGGGTGGTGG + Intergenic
1120278267 14:82406395-82406417 CTGAGGTTGGTTAAGTGTCCTGG + Intergenic
1125206912 15:37163669-37163691 ATAAGGTGGTTGAAGTCTGCAGG - Intergenic
1131136158 15:89937624-89937646 CTAAGGATGATGAAGTGGAGAGG - Intergenic
1131788780 15:95941438-95941460 ATAAGGTGGAAGAAGGGTGCTGG - Intergenic
1139460042 16:67114587-67114609 AAAAGGTAGATGATGTGTGCAGG + Intronic
1162770706 19:12948005-12948027 CCAAGGTGGGTGACGTGTGCTGG + Exonic
1166193539 19:41192094-41192116 ATAAGATTCATGAAGTCTGCAGG - Intergenic
1166965486 19:46527273-46527295 CTAAGGTTGATGAAGTGTGCCGG - Intronic
928069412 2:28199621-28199643 CTAAGGCTGAAGAAGAGTTCAGG + Intronic
928907878 2:36386992-36387014 ATGAGGTTGAAGAAGTTTGCTGG + Intronic
929490845 2:42394817-42394839 CCAAGGTTGAGGACGTGTGCCGG - Intronic
931431335 2:62211244-62211266 CTCAGGATGCTGAAGTGTGGGGG + Intronic
940038230 2:149331189-149331211 CTAAGGGAGGTGCAGTGTGCTGG + Intronic
942016673 2:171824289-171824311 CTAAGGATGAAGAAATGTGAAGG + Intronic
942595782 2:177590827-177590849 CTAAGATTGATGAGTTTTGCTGG + Intergenic
943291849 2:186083115-186083137 AGAAGTTTGATTAAGTGTGCTGG - Intergenic
944268789 2:197758714-197758736 CTAAAATTAATGAAGAGTGCTGG + Intronic
944946587 2:204694091-204694113 GGAAGGTTGAAAAAGTGTGCAGG + Intronic
944967243 2:204948943-204948965 CTAAAGTTGATGAACTGTACTGG + Intronic
1172482364 20:35278305-35278327 CTAAGGTGGATGGAGGTTGCAGG - Intergenic
1176675575 21:9774354-9774376 CTGAGGTGGATGATGGGTGCTGG - Intergenic
1182054284 22:27337818-27337840 CTCAGAATGATGAGGTGTGCGGG + Intergenic
1184917291 22:47578690-47578712 CCAAGGTTGAAGATGTGTGCCGG - Intergenic
953578011 3:44128688-44128710 CACAGGGTGGTGAAGTGTGCAGG + Intergenic
958865726 3:99499370-99499392 CTCTGGTGGATGAAGAGTGCTGG - Intergenic
960439601 3:117670498-117670520 CTGAGCCTGAAGAAGTGTGCAGG - Intergenic
961916826 3:130384660-130384682 CTGTGCTTAATGAAGTGTGCAGG + Intronic
961977310 3:131040343-131040365 CTAAGCCTGATGAAATGTGTGGG + Intronic
965758084 3:172045368-172045390 CTAGTGTTGCTGAAGTGGGCAGG + Intronic
966454867 3:180102990-180103012 GTAGGGTTGCTGCAGTGTGCTGG - Intergenic
966511512 3:180768727-180768749 CTAAGGTTGCTGAATTGGCCTGG + Intronic
969660036 4:8521991-8522013 CTGAGGATGCAGAAGTGTGCAGG - Intergenic
971169844 4:24222230-24222252 AGAAGGTTGATGAAGAGTCCTGG - Intergenic
975660360 4:76682441-76682463 CTAAGGATGGTGGAGTGTGGTGG - Intronic
977668158 4:99664939-99664961 CCATGGGTGATGAAGGGTGCAGG + Intergenic
978802813 4:112771506-112771528 CTGAGCTTGATGAGGTGTGGAGG + Intergenic
978973574 4:114840669-114840691 CTAAGATAGATGAGGTATGCGGG + Intronic
980841441 4:138266181-138266203 CTGAGGGTGATGAAGGGTCCAGG - Intergenic
985399967 4:189584334-189584356 CTAAGGTGGATGATGGGTGCTGG + Intergenic
986179436 5:5379673-5379695 CCAAGGTTGAGGATGTGTCCAGG - Intergenic
986865605 5:11982768-11982790 TTAATTTTGATGAAGTGTGAAGG - Intergenic
989964268 5:50450385-50450407 GTAAGGTTGATGACATGAGCTGG + Intergenic
994157871 5:96523609-96523631 CTAAGGTGGAAGAAGTCTGCAGG + Intergenic
997068814 5:130594523-130594545 CTAATGTAGATGAAGGGTGATGG + Intergenic
999396991 5:151235789-151235811 CTAACGTTGGTCAAGTGTGTTGG + Intronic
1003323696 6:5075882-5075904 CTAAGGTGTATGAAGTGGGAGGG - Intergenic
1004812335 6:19274426-19274448 CTGAGGGTGATGACGTGAGCTGG - Intergenic
1006752210 6:36385778-36385800 TTAAGGTTGATGCAGTCTTCTGG - Intronic
1010946351 6:81977765-81977787 TTAATGTAGCTGAAGTGTGCAGG - Intergenic
1012144914 6:95669384-95669406 CTAAGGTAGCTGAAGTGTACAGG - Intergenic
1014366721 6:120552525-120552547 CAAATGATGATAAAGTGTGCAGG + Intergenic
1015405570 6:132833750-132833772 GTAAGGATGATGAAGGGTGCTGG - Intergenic
1020656260 7:10931292-10931314 CTCATGTTAATGAAGTCTGCAGG - Intergenic
1021028009 7:15693242-15693264 TTAAAGATGATTAAGTGTGCTGG + Intergenic
1021364920 7:19765894-19765916 CTAGGGTTGATGAAAGGTGTGGG + Intronic
1022014211 7:26335148-26335170 CTTCGGTTGCTGAAGTGTGCAGG - Intronic
1023217045 7:37873803-37873825 CTAATGTTGATTAGGAGTGCTGG + Intronic
1024345682 7:48310742-48310764 CTAAAGATGATGAAGTCTGCAGG + Intronic
1024572218 7:50732707-50732729 GAAAGCTTGATGAAGTTTGCAGG - Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1029029527 7:97453248-97453270 CCAAGGTTGAGGAAGTGTCAAGG + Intergenic
1030009365 7:105150950-105150972 CAAAGGTTGATTCACTGTGCGGG + Intronic
1032805753 7:135352646-135352668 CTAAGATTGATGAACAGTCCAGG + Intergenic
1033148810 7:138895083-138895105 CAAATGTTTATTAAGTGTGCTGG + Intronic
1034834347 7:154337824-154337846 CTAAGGTAGTTGCAGTTTGCTGG + Intronic
1039999595 8:42564945-42564967 GTAAGGTTGATGACATGAGCTGG + Intergenic
1041734302 8:61093775-61093797 CTAAGGTAGCTGAAGAGAGCTGG - Intronic
1045941276 8:107741140-107741162 GGAAGATTGATGAAGTGTCCAGG - Intergenic
1046688841 8:117259576-117259598 CTAAGGTTGGAGAATTGAGCAGG - Intergenic
1047323344 8:123811237-123811259 GTAAGGTTGAAGAAGAGGGCCGG + Intronic
1051561343 9:18444239-18444261 CTAAGGGTGAGGCATTGTGCTGG + Intergenic
1052649828 9:31288179-31288201 CTAAGGATTATGAATTGTGTGGG + Intergenic
1053428266 9:38025312-38025334 CAGAGGTTGATGGAGTCTGCAGG - Intronic
1057386458 9:94609602-94609624 ATAGGGATGATGAAGTGTGCTGG - Intronic
1058875251 9:109238573-109238595 CTCAGATTGATGCAGTGTACAGG + Intronic
1061057258 9:128230746-128230768 CTAAAATTTATGAAGTGGGCTGG - Intronic
1061802213 9:133118926-133118948 CTAAGGCAGATGAAGTGAGGGGG + Intronic
1187685584 X:21812603-21812625 CCAGGGTTGATGATGTGCGCAGG + Intergenic
1192310900 X:70013284-70013306 CTGTGGTTGCTGCAGTGTGCTGG - Intronic
1192595047 X:72397576-72397598 CTAGGGTGGAGGAAGTGTGCAGG - Intronic
1193726090 X:85041262-85041284 GTAAGGCTGCTGCAGTGTGCTGG + Intronic
1194114585 X:89880366-89880388 CTAAGAGTGAAGAAGTGTGATGG + Intergenic
1197312923 X:124928369-124928391 CTAAGTTTGATGTAGTATGTTGG - Intronic
1199730741 X:150629784-150629806 ATGAGGTAGCTGAAGTGTGCCGG - Intronic