ID: 1166969919

View in Genome Browser
Species Human (GRCh38)
Location 19:46559427-46559449
Sequence GCATTGGAGGACCCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166969912_1166969919 17 Left 1166969912 19:46559387-46559409 CCCTGCCAAATATGATGATGTCA 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG 0: 1
1: 1
2: 3
3: 19
4: 67
1166969913_1166969919 16 Left 1166969913 19:46559388-46559410 CCTGCCAAATATGATGATGTCAA 0: 1
1: 1
2: 13
3: 25
4: 167
Right 1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG 0: 1
1: 1
2: 3
3: 19
4: 67
1166969911_1166969919 30 Left 1166969911 19:46559374-46559396 CCATCTGGGAAAACCCTGCCAAA 0: 1
1: 0
2: 0
3: 15
4: 250
Right 1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG 0: 1
1: 1
2: 3
3: 19
4: 67
1166969914_1166969919 12 Left 1166969914 19:46559392-46559414 CCAAATATGATGATGTCAAGAAA 0: 1
1: 0
2: 2
3: 39
4: 387
Right 1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG 0: 1
1: 1
2: 3
3: 19
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166969919 Original CRISPR GCATTGGAGGACCCCCTCAA GGG Intronic
904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG + Intronic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
912456660 1:109802726-109802748 GCATAGGAGGATCCCCACACTGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
913503669 1:119496029-119496051 GAATTGGAAGGCTCCCTCAAGGG - Intergenic
919419824 1:197355825-197355847 GCATTGTGGGAGCCCCTCTATGG - Intronic
920988702 1:210915143-210915165 GCTTTTGAGGAATCCCTCAAAGG - Intronic
922749916 1:228065459-228065481 TCCTTGGAGGACCCCCTCCAAGG - Intergenic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1072091970 10:92137576-92137598 GAATTGGTGGACCCCCTCCAGGG - Intronic
1076040903 10:127247736-127247758 GCATTGTGAGACCCCCTCAAGGG + Intronic
1076782458 10:132731726-132731748 GCACTGGAGGAAACCCTCACTGG - Intronic
1080002461 11:27364880-27364902 GCAATGCTGGACCCCCCCAAGGG + Intergenic
1081582822 11:44364222-44364244 GCATTGGAGCACATCCTGAAAGG - Intergenic
1083999991 11:66290874-66290896 GCATTAGATGACCCCCTCCCAGG - Intergenic
1084374397 11:68766184-68766206 ACCTTGAAGGACCCCTTCAAGGG + Intronic
1089713373 11:120334110-120334132 CCATTGGAAAACCTCCTCAAAGG + Intergenic
1090199369 11:124843320-124843342 CCTTCGGAGGACCCCCTCCAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1110933359 13:81250947-81250969 AGATTGAAGGACCCCCTCATTGG - Intergenic
1111757362 13:92415282-92415304 GAATTGGAGGAAGCCCTGAATGG + Intronic
1122778258 14:104132559-104132581 GCATTGCAGAACCCCCTCCAGGG + Intergenic
1122866231 14:104605204-104605226 GCATTTCGGGACCCCCGCAAAGG - Intronic
1127727712 15:61766595-61766617 GCATTCGAGGCCCACCACAATGG + Intergenic
1130067733 15:80618660-80618682 TCACTGGAGGATCCCCTTAAGGG + Intergenic
1132564488 16:615196-615218 GCATCGAAGGACACCATCAATGG - Intronic
1138584223 16:57960102-57960124 GGGTTGGAGGAAGCCCTCAAGGG - Intronic
1139252927 16:65513517-65513539 GCAATGGATGAACACCTCAAAGG + Intergenic
1150295484 17:64005162-64005184 GCATTGGAGGACCGTGTCATGGG + Exonic
1152698961 17:81809975-81809997 GCCTTTGAGGACCCCGCCAAGGG + Intronic
1157875877 18:51273319-51273341 GCAGTGGAGGACCTTGTCAATGG - Intergenic
1163885080 19:19958252-19958274 GCACTGGATGAACCCCTGAATGG - Intergenic
1163885877 19:19964380-19964402 GCACTGGATGAACGCCTCAAGGG - Intergenic
1163898061 19:20077014-20077036 GCACTGGATGAACGCCTCAAGGG + Intergenic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166679859 19:44759548-44759570 GCCTCGGAGGACCCCAGCAAAGG - Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926170828 2:10551605-10551627 GCATGGGAAGAACGCCTCAAGGG + Intergenic
937482623 2:122278030-122278052 GCATTGGAGTTTCCCCTCCACGG - Intergenic
939117085 2:138072659-138072681 GCACTGAAGGACCCTGTCAAAGG - Intergenic
1170708058 20:18763719-18763741 GTATTGGAGAACCCCCGCCATGG - Exonic
1177950803 21:27534318-27534340 ACTTTGGATGACTCCCTCAAGGG - Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1180150637 21:45945482-45945504 GCGTTGGAAGACCCCCTCCCTGG + Intergenic
1184100673 22:42340420-42340442 GCAGTGGAGGTCCCTTTCAATGG - Intronic
1184105867 22:42367289-42367311 GCATGGGACCACCCCCTCCATGG - Intergenic
955126518 3:56117583-56117605 GGATAAGAGGACTCCCTCAAGGG + Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
966542514 3:181107637-181107659 GCATTGGAGCACTGCCTCCAGGG + Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
980234406 4:130086493-130086515 GCACTGGAGGACCCCCTCTTAGG + Intergenic
980870293 4:138603453-138603475 GCATTGGAGTAGCACCACAAAGG + Intergenic
985090650 4:186359521-186359543 GCACTGGATGAACACCTCAAGGG + Intergenic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
989260251 5:39411542-39411564 GCCTTGGAGGATCCACTCCATGG + Intronic
993295509 5:86133786-86133808 TCACTGGAGGACCATCTCAAAGG + Intergenic
994041063 5:95260266-95260288 GCACTGGATGAGCGCCTCAAGGG - Intronic
994447885 5:99900855-99900877 GCATTGGAGGTCCTCCTGATAGG + Intergenic
1000300312 5:159950686-159950708 GCATTGGAGTGTCCCCCCAAGGG - Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1005534246 6:26738580-26738602 GCACTGGATGAACACCTCAATGG - Intergenic
1005536549 6:26763074-26763096 GCACTGGATGAACACCTCAATGG + Intergenic
1005735962 6:28746446-28746468 GCACTGGATGAACACCTCAAGGG + Intergenic
1009007448 6:57805488-57805510 GCACTGGATGAACACCTCAATGG + Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1014333396 6:120100017-120100039 GCACTGGATGAACACCTCAAGGG - Intergenic
1017976088 6:159358693-159358715 GCATGGGAGGAGCCCCACCAGGG - Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1029407319 7:100383319-100383341 GCCTTGGAGGACCCCATCTGTGG - Intronic
1029519804 7:101052796-101052818 TCATTTGAGGACCACCTCCAGGG + Intronic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1030412082 7:109193308-109193330 GCACTGGATGAACGCCTCAAGGG + Intergenic
1031636908 7:124112501-124112523 GCATTATAGGACCACCTAAATGG + Intergenic
1033682358 7:143607221-143607243 GCTTTGAATGACCCCATCAATGG + Intergenic
1033702531 7:143854692-143854714 GCTTTGAATGACCCCATCAATGG - Intronic
1034430707 7:151039963-151039985 GCACTGGAGGACACCCACAGAGG + Intronic
1035388815 7:158491401-158491423 GGATTGGAGGCTCCCGTCAATGG - Intronic
1047727923 8:127700703-127700725 GGGCTGGAGGACCCACTCAAAGG + Intergenic
1053210300 9:36222035-36222057 TCCCTGGAGGACCACCTCAAAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189973394 X:46439899-46439921 GCGTTGAAGGCCCCCCTCAAGGG - Intergenic
1195113474 X:101670464-101670486 GGATTGGAGGACACAATCAAAGG - Intergenic
1199680680 X:150222291-150222313 CCATTGGAGTACCAGCTCAAGGG + Intergenic