ID: 1166972085

View in Genome Browser
Species Human (GRCh38)
Location 19:46575752-46575774
Sequence AGAGACAAGGTCCCATCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 713
Summary {0: 1, 1: 0, 2: 9, 3: 105, 4: 598}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166972085_1166972088 11 Left 1166972085 19:46575752-46575774 CCACATGATGGGACCTTGTCTCT 0: 1
1: 0
2: 9
3: 105
4: 598
Right 1166972088 19:46575786-46575808 AAAAAAAAAAAAAAAAGATTGGG 0: 233
1: 3034
2: 14195
3: 69954
4: 97240
1166972085_1166972089 14 Left 1166972085 19:46575752-46575774 CCACATGATGGGACCTTGTCTCT 0: 1
1: 0
2: 9
3: 105
4: 598
Right 1166972089 19:46575789-46575811 AAAAAAAAAAAAAGATTGGGTGG 0: 3
1: 173
2: 1690
3: 15667
4: 45576
1166972085_1166972087 10 Left 1166972085 19:46575752-46575774 CCACATGATGGGACCTTGTCTCT 0: 1
1: 0
2: 9
3: 105
4: 598
Right 1166972087 19:46575785-46575807 AAAAAAAAAAAAAAAAAGATTGG 0: 532
1: 7039
2: 49070
3: 65067
4: 122788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166972085 Original CRISPR AGAGACAAGGTCCCATCATG TGG (reversed) Intronic
901600913 1:10422759-10422781 TGAGACAAGGTCTCATTCTGTGG + Intergenic
901639123 1:10684488-10684510 AGAGACATGGTCCATTCAGGAGG + Intronic
901950684 1:12743469-12743491 AGAGACAGGGTTTCATCATGTGG + Intergenic
901963770 1:12849142-12849164 AGAGACAGGGTTTCACCATGTGG - Intronic
901991407 1:13117240-13117262 AGAGACAGGGTTTCACCATGTGG - Intergenic
902303039 1:15516302-15516324 AGAGACAGGGTCTCACCATGTGG - Intronic
902509347 1:16957628-16957650 AGAGACAGGGTTTCACCATGTGG + Intronic
902901828 1:19522637-19522659 AGAGACAGGGTTTCACCATGTGG + Intergenic
903120267 1:21211984-21212006 AGAGACAAGGTTTCACCATGTGG - Intergenic
903423613 1:23236694-23236716 AGAGACAGGGTTTCACCATGTGG + Intergenic
903749619 1:25612924-25612946 AGAGACAGGGTTTCACCATGTGG + Intergenic
903817059 1:26071965-26071987 AGAGACGGGGTTTCATCATGTGG + Intergenic
904027801 1:27515660-27515682 AGAGACAGGGTTTCACCATGTGG - Intergenic
904174604 1:28617776-28617798 AGAGACAAGGTCTCATTATATGG + Intronic
904400799 1:30255062-30255084 AGAGCCAGGGACCCATCAGGAGG + Intergenic
904405891 1:30287673-30287695 AGAGACCAGATCCCAAAATGTGG + Intergenic
904758927 1:32787310-32787332 AGAGACAGGGTTTCATCATGTGG + Intronic
905623956 1:39474508-39474530 AGAGACAGGGTTTCACCATGTGG - Intronic
905780741 1:40706982-40707004 AGAGACAGGGTTTCACCATGTGG - Intronic
905904494 1:41608883-41608905 AGAGACAGGGTTTCACCATGTGG - Intronic
906344521 1:45006829-45006851 AGAGCCCAGCTCCCATAATGGGG + Intronic
906885185 1:49637486-49637508 AGAGACAGGGTTTCACCATGTGG + Intronic
907359152 1:53900832-53900854 AGAGACAGGGTCTCATTCTGTGG + Intronic
909642278 1:77882415-77882437 AGAGACAGGGTCTCATTTTGTGG - Intergenic
909940162 1:81602272-81602294 AGAGACAGGGTTTCATCATGTGG - Intronic
910204575 1:84735377-84735399 AGAGACAAGGTCTTATTCTGTGG - Intergenic
910993206 1:93077214-93077236 AGAGACAGGGTCTCACTATGTGG + Intergenic
912374691 1:109200692-109200714 AAAGACAAGATCCCAAAATGTGG - Intronic
913104576 1:115600654-115600676 AGAAACAAGGTCTCACTATGTGG - Intergenic
916026044 1:160834536-160834558 AGAGACAGGGTTTCACCATGTGG + Intronic
916217942 1:162414190-162414212 AGAGACAGGGTTTCACCATGTGG + Intergenic
916774864 1:167951387-167951409 AGAGACAGGATTTCATCATGTGG - Intronic
916794144 1:168150122-168150144 AGAGACAAGGTCTCCCTATGTGG - Intergenic
916921763 1:169476531-169476553 AGAGACGGGGTTTCATCATGTGG - Intronic
917100242 1:171438008-171438030 AGAGACAGGGTTTCACCATGTGG + Intergenic
917380823 1:174405790-174405812 AGAGACAGGGTTTCACCATGTGG - Intronic
917816431 1:178714590-178714612 AGAGACAAGGTCTCACTCTGTGG + Intergenic
918475758 1:184922790-184922812 AGAGACAGGGTTTCACCATGTGG + Intronic
919691744 1:200533842-200533864 AGAGACAGGGTTTCATCATGTGG + Intergenic
919693509 1:200548634-200548656 AAAGACCAGGTCTCATTATGTGG + Intergenic
919984693 1:202664842-202664864 AGAGACAGGGTTTCACCATGTGG + Intronic
920162952 1:204013721-204013743 AGAGACAGGGTCTCACCATGTGG - Intergenic
920411668 1:205766373-205766395 AGAGACATGGTTTCACCATGTGG - Intergenic
920843560 1:209575126-209575148 AGAGACAAGTCCTCAGCATGAGG - Intergenic
921391798 1:214623023-214623045 AGAGACAAGGTTTTGTCATGTGG - Intronic
921472280 1:215563670-215563692 AGAGACAAGGTTTCACCATGTGG + Intergenic
922168088 1:223132175-223132197 AGAGACAAGGTCTCACTATGTGG - Intronic
922886033 1:229021450-229021472 AGAGATGAGGTCTCATTATGTGG + Intergenic
922913062 1:229233566-229233588 AGAGTCAAGGTCCGGTCATCTGG - Intergenic
923560079 1:235032512-235032534 AGAGACAGGGTTTCACCATGTGG - Intergenic
923567482 1:235087371-235087393 AGAGACAGGGTTTCACCATGTGG + Intergenic
923632226 1:235658809-235658831 AGAGACGAGGTTTCACCATGTGG - Intergenic
924057318 1:240136883-240136905 AGAGACAGGGTTTCACCATGTGG - Intronic
924737472 1:246771119-246771141 ACTGAAAAGGTCCCATCATATGG + Intergenic
924743301 1:246810433-246810455 AGAGACAGGGTTTCACCATGTGG + Intergenic
1063259033 10:4363244-4363266 AGAGACGAGGTTTCACCATGTGG - Intergenic
1063842902 10:10091937-10091959 AGAGACGAGGTTTCACCATGTGG - Intergenic
1064009121 10:11721289-11721311 AGAGACAAGGTCTCACTATATGG + Intergenic
1064053349 10:12077410-12077432 AGAGACAGGGTTTCACCATGTGG + Intronic
1064143678 10:12810623-12810645 AGAGGCAGGGTCCCATCAGAGGG + Intronic
1064379550 10:14828818-14828840 AGAGACAAGGTCTCACTATGTGG - Intronic
1065590205 10:27256086-27256108 AGAGACAGGGTTTCACCATGTGG - Intergenic
1065812029 10:29451119-29451141 AGAGACAAGGTCTCACTGTGTGG + Intergenic
1065813557 10:29464249-29464271 AGAGATAGGGTCTCATCATGTGG - Intronic
1066086425 10:31976253-31976275 AGAGACAAGGTCTCACTCTGTGG - Intergenic
1066370977 10:34817882-34817904 AGAGATAAGGTCTCACTATGTGG + Intergenic
1066382388 10:34912413-34912435 AGAGACAGGGTTTCACCATGTGG - Intergenic
1066384550 10:34931098-34931120 AGAGACAAGGTTTCACCATTTGG + Intergenic
1066551720 10:36565680-36565702 AGAGACAAGGTTTCACTATGTGG + Intergenic
1066665083 10:37774954-37774976 AGAGACTGGGTCTCACCATGTGG + Intergenic
1067055589 10:43048095-43048117 AGAGACAAGGTCTCACTATGTGG + Intergenic
1068666471 10:59680793-59680815 AGAAACAAGGTCTCACCATGTGG - Intronic
1068789227 10:61009093-61009115 AGAGACAAGGTCTCACTCTGTGG + Intergenic
1069464842 10:68629177-68629199 AGAGACAGGGTTTCACCATGTGG - Intronic
1069700222 10:70419000-70419022 AGAGACAGGGTCTCACTATGTGG + Intronic
1069866696 10:71508182-71508204 AGACACAAGGTCCATTCATGTGG - Intronic
1070548036 10:77468191-77468213 AGAGACAGGGTTTCACCATGTGG + Intronic
1070573626 10:77660556-77660578 AGAGACAGGGTTTCACCATGTGG + Intergenic
1071124232 10:82315849-82315871 AGAGACAGGGTTTCACCATGTGG + Intronic
1071485791 10:86101837-86101859 AGAGACAGAGTCTCATTATGGGG + Intronic
1071697495 10:87891932-87891954 AGAGACCAGGTCTCATGATGTGG - Intronic
1071892370 10:90024455-90024477 AGAGACAGGGTTTCACCATGGGG + Intergenic
1072083920 10:92059769-92059791 AGAGACAGGGTTTCACCATGTGG - Intronic
1072211737 10:93252616-93252638 AGAGACAGGGTTTCACCATGTGG - Intergenic
1072681107 10:97507449-97507471 AGAGACGAGGTCTCACTATGTGG - Intronic
1072707906 10:97695319-97695341 AGAGACAGGGTTTCACCATGTGG + Intergenic
1072972540 10:100029580-100029602 AGAGACACGGTTTCACCATGTGG - Intergenic
1073321852 10:102620434-102620456 AGAGTCAGGGCCCCAGCATGTGG + Intronic
1073396310 10:103221011-103221033 AGAGACAAGGTCTCACTATGTGG - Intergenic
1074586991 10:114777561-114777583 AGAGACAAAGTCCCACTAGGAGG - Intergenic
1075120457 10:119660658-119660680 AGAGACAAGGTCTCACTATGGGG - Intronic
1075154168 10:119960323-119960345 ACAGAAAAGATCTCATCATGAGG - Intergenic
1075363312 10:121859754-121859776 AGAGACAGGGTTTCACCATGTGG - Intronic
1076562404 10:131375766-131375788 AGTAACAAGGACCCATCCTGTGG - Intergenic
1077177338 11:1196801-1196823 AGAGGCAGGGTCCCATATTGGGG - Intronic
1077507661 11:2939485-2939507 AGAGACAGGGTTTCACCATGTGG - Intergenic
1078220968 11:9351321-9351343 AGAGACAAGGTTTCGCCATGTGG + Intergenic
1078862035 11:15257570-15257592 CCAGATAAGGTCCCATTATGAGG - Intergenic
1078899947 11:15632495-15632517 AGAGACAGGGTTTCACCATGTGG + Intergenic
1080153797 11:29084174-29084196 AGAGACAAGGTCTCACTACGTGG + Intergenic
1080447782 11:32353106-32353128 AGAGACAGGGTTTCACCATGTGG - Intergenic
1080630613 11:34071375-34071397 AGAGACAGGGTTTCACCATGTGG - Intronic
1080788845 11:35501316-35501338 AGAGACAGGGTTTCATCATGTGG + Intronic
1081465548 11:43312919-43312941 AGAGACAGGGTTTCACCATGTGG - Intronic
1081647759 11:44801844-44801866 AGAGACAGGGTCTCACTATGTGG - Intronic
1081769449 11:45639381-45639403 AGAGACGGGGTTTCATCATGTGG + Intergenic
1081926285 11:46831715-46831737 AGAGACAGGGTCTCACTATGTGG + Intronic
1082043251 11:47704292-47704314 AGAGACGGGGTTTCATCATGTGG - Intronic
1082081657 11:48016947-48016969 AGAGACAGGGTCTCATGTTGTGG + Intronic
1082831074 11:57617741-57617763 AGAGACGAGGTTTCACCATGTGG - Intergenic
1083250650 11:61464408-61464430 AGAGACAAGGTCTCACTATGTGG + Intronic
1083327646 11:61881124-61881146 AGAGACAAGGTCTCACTATGTGG - Intronic
1083358953 11:62091775-62091797 AGAGACAGGGTTTCACCATGTGG - Intergenic
1083665930 11:64274633-64274655 AGAGACAGGGTTTCACCATGTGG - Intronic
1084127271 11:67107963-67107985 AGAAATATGGTCCCATCAAGAGG + Intergenic
1085187834 11:74591377-74591399 AGAGACAGGGTTTCACCATGTGG + Intronic
1085633672 11:78141019-78141041 AGAGACAGGGTCTCATTCTGTGG + Intergenic
1086195024 11:84127618-84127640 ACAGACAAGGTCTCACTATGCGG + Intronic
1086245588 11:84748186-84748208 AGAGACAAGGTGCATTCAGGAGG + Intronic
1087530865 11:99380582-99380604 AGAGACAGGGTCTCACCATGTGG - Intronic
1087800194 11:102495580-102495602 AGAGAAAGGGTGCCCTCATGTGG + Intronic
1088110204 11:106251899-106251921 AGAGACGAGGTTTCACCATGTGG + Intergenic
1088311267 11:108463104-108463126 AGAGACATGGTCTCATTTTGTGG - Intronic
1088828494 11:113515678-113515700 AGAGAGAAGGCCCCATCAGGAGG - Intergenic
1088934961 11:114390446-114390468 AGAGACAGGGTTTCACCATGTGG - Intergenic
1090219864 11:125010544-125010566 AGAGACAGGGTTTCACCATGTGG + Intronic
1091443319 12:528233-528255 AGAGACGGGGTCTCATCATATGG + Intronic
1091526969 12:1312542-1312564 AGAGACGAGGTTTCACCATGTGG + Intronic
1092154410 12:6273284-6273306 AGAGACAGGGTCTCGCCATGTGG + Intergenic
1092280983 12:7097466-7097488 AGAGACGGGGTTTCATCATGTGG + Intronic
1092343198 12:7693752-7693774 AGAGATGAGGTCTCACCATGAGG - Intronic
1092703752 12:11261907-11261929 AGAGACAGGGTTTCACCATGTGG - Intergenic
1092707098 12:11296966-11296988 AGAGACAGGGTTTCACCATGTGG - Intergenic
1094077217 12:26490624-26490646 AGAGACAGGGTTTCATCCTGTGG - Intronic
1094134566 12:27110570-27110592 AGAGACAGGGTCTCACTATGTGG + Intergenic
1094184687 12:27628362-27628384 AGAGACAGGGTCTCACTATGTGG + Intronic
1094537794 12:31337267-31337289 AGAGACAAGGTCTCACTATGTGG - Intergenic
1095463554 12:42467065-42467087 AGAGACGGGGTCTCACCATGGGG + Intronic
1095473575 12:42562995-42563017 AGAGACAGGGTTTCACCATGTGG - Intronic
1095747207 12:45673077-45673099 AGAGACAAGGTCTCACTCTGTGG + Intergenic
1097278751 12:57831268-57831290 AGAGACAGGGTTTCACCATGTGG - Intronic
1098056674 12:66513895-66513917 AGAGACAAGGTCTCATCCACTGG - Intronic
1098125063 12:67282575-67282597 AGAGACAAGGTCTCACTCTGTGG + Intronic
1098186015 12:67897148-67897170 AGAGACGAGGTCCCACCATTTGG + Intergenic
1098330521 12:69347567-69347589 AGAGACAGGGTTTCACCATGTGG - Intergenic
1099274247 12:80555098-80555120 AGAGACAGGGTTTCACCATGTGG + Intronic
1099565148 12:84233022-84233044 AGAGACAAGGTTTCACCATGTGG - Intergenic
1099578410 12:84408423-84408445 AGAGACAAGATCTCACCATGTGG - Intergenic
1099954730 12:89342707-89342729 AGAGACAGGGTTTCACCATGTGG + Intergenic
1100548689 12:95626825-95626847 AGAGACAAGGTTTCACCATGTGG - Intergenic
1100642920 12:96499758-96499780 AGAGACAGGGTTTCACCATGTGG - Intronic
1101467109 12:104959310-104959332 AGAGACAAGGTCTCATTTTGTGG - Intergenic
1101511340 12:105395168-105395190 AGAGACAAGATCTCACCATTTGG + Intronic
1102291130 12:111700942-111700964 AGAGACAGGGTTTAATCATGTGG + Intronic
1102894294 12:116586283-116586305 AGAGCCAAGATTCCAACATGGGG - Intergenic
1103023732 12:117556977-117556999 AGAGACAGGGTTTCACCATGTGG - Intronic
1103630336 12:122254863-122254885 AGAGACAGGGTTTCACCATGTGG - Intronic
1103933923 12:124465399-124465421 AGACACAAGGTTCCACCTTGGGG + Intronic
1104565402 12:129876752-129876774 AGAAATAAGGTCCCATTTTGTGG - Intronic
1104679419 12:130739197-130739219 AGAGACAGGGTTTCACCATGTGG + Intergenic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1105516450 13:21095120-21095142 AGAGACAGGGTTTCACCATGTGG + Intergenic
1105981080 13:25516964-25516986 AGAGACAGGGTTTCACCATGTGG + Intronic
1106320445 13:28632681-28632703 AGAGACAGGGTTTCACCATGTGG + Intergenic
1106711163 13:32334652-32334674 AGGGACAAGGTCTCATTTTGTGG - Intronic
1107443258 13:40447010-40447032 AGAGACGGGGTTCCACCATGTGG - Intergenic
1107527246 13:41245425-41245447 AGAGACAAGATCTCACCATGTGG + Intronic
1107809208 13:44183446-44183468 AGAGACAGGGTTTCACCATGTGG + Intergenic
1108285418 13:48902563-48902585 AGAGAAAAGGTCCCATCTTGAGG + Intergenic
1108395160 13:49984636-49984658 AGAGACAAGGTCTCACTAGGTGG - Intergenic
1108551281 13:51547603-51547625 AGACACAAGGTTTCATTATGTGG - Intergenic
1108988029 13:56618895-56618917 AGAGACAGGGTTTCACCATGTGG - Intergenic
1109596029 13:64554753-64554775 AGAGACAGGGTTTCATCATGTGG + Intergenic
1109943983 13:69407501-69407523 AGAGACAGGTTTTCATCATGTGG - Intergenic
1110095575 13:71515609-71515631 AGGGACAAAATCCCATTATGTGG + Intronic
1112347671 13:98604229-98604251 GGAGACAGGGTTTCATCATGTGG + Intergenic
1112352559 13:98648764-98648786 AGAGACAAGGTCTCAGTATGTGG + Intergenic
1112456889 13:99571147-99571169 AGAGACAGGGTTTCACCATGTGG - Intergenic
1112795257 13:103049961-103049983 AGAAACAGGGTCTCATTATGTGG - Intronic
1113853601 13:113431900-113431922 AGAGACGAGGTTTCACCATGGGG + Intronic
1113870412 13:113555944-113555966 AGAGACAGGGTTTCACCATGTGG - Intergenic
1113975347 13:114224092-114224114 AGAGACGGGGTCTCATCATGTGG - Intergenic
1114064001 14:19044607-19044629 AGAGACGGGGTTCCACCATGTGG + Intergenic
1114098258 14:19355389-19355411 AGAGACGGGGTTCCACCATGTGG - Intergenic
1114471670 14:22967475-22967497 AGAGTCAGGGTCCCACTATGTGG + Intronic
1115841433 14:37475148-37475170 AGAGACAGGGTTTCACCATGTGG + Intronic
1115889053 14:38006696-38006718 AGAGACAGGGTTTCACCATGTGG - Intronic
1116531827 14:45981006-45981028 AGACACAAGCTCTTATCATGTGG - Intergenic
1116809344 14:49524337-49524359 AGAGACAAGGTCTCACTATGTGG + Intergenic
1116972596 14:51082107-51082129 AGTGACCAGCTCCCATCCTGAGG + Intronic
1117685587 14:58249689-58249711 AGAGACAGGGTTTCACCATGTGG + Intronic
1118265504 14:64290587-64290609 AGAGACAAGGTTTCATTATTTGG + Intronic
1118672900 14:68149618-68149640 AGAGATGAGGTCCCACTATGTGG + Intronic
1119058722 14:71451446-71451468 AGAGACAAGGTCTCACTATATGG - Intronic
1119333828 14:73815769-73815791 AGAGACAAGGTCTCGCCATGTGG - Intergenic
1119707137 14:76790048-76790070 AGAGACGGGGTTTCATCATGTGG + Intronic
1120436274 14:84487028-84487050 AGAGACAAGGTCTCATTATGTGG - Intergenic
1121100932 14:91249767-91249789 AGAGACAAGGTCTCACCATGTGG + Intronic
1121344235 14:93123462-93123484 AGAGACAGGGTTTCACCATGTGG + Intergenic
1121344256 14:93123596-93123618 AGAGACAGGGTTTCACCATGTGG + Intergenic
1121391265 14:93576958-93576980 AGAGACAAGGTCTCATTATGTGG - Intronic
1121651878 14:95564718-95564740 AGAGACAAGGTCATATTATGTGG - Intergenic
1121668179 14:95688180-95688202 AGAGACAAAGTTTAATCATGTGG + Intronic
1122979216 14:105184045-105184067 AGAGATAGGGTCTCATGATGTGG + Intergenic
1122980415 14:105189533-105189555 AGAGACAAGGTCTCGTTCTGTGG - Intergenic
1123440680 15:20289027-20289049 AGTGACAAAGTCCCAGTATGTGG + Intergenic
1123464078 15:20501288-20501310 AGAGACAGGGTTTCACCATGGGG + Intergenic
1123464184 15:20502457-20502479 AGAGACAGGGTTCCACCATGTGG - Intergenic
1123653881 15:22497965-22497987 AGAGACAGGGTTCCACCATGTGG + Intergenic
1123653987 15:22499134-22499156 AGAGACAGGGTTTCACCATGGGG - Intergenic
1123668361 15:22628429-22628451 AGAGACAGGGTTTCACCATGTGG + Intergenic
1123926261 15:25114734-25114756 AGAGACAGGGTTTCACCATGTGG + Intergenic
1123994157 15:25706638-25706660 ATAGTCAAGGTTTCATCATGTGG + Intronic
1124253967 15:28125995-28126017 AGAGACAGGGTTTCACCATGTGG + Intronic
1124274909 15:28318439-28318461 AGAGACAGGGCTCCACCATGTGG - Intronic
1124307789 15:28593164-28593186 AGAGACAGGGTTCCACCATGTGG + Intergenic
1124307893 15:28594331-28594353 AGAGACAGGGTTTCACCATGGGG - Intergenic
1124524335 15:30434871-30434893 AGAGACAGGGTTTCACCATGTGG + Intergenic
1124534330 15:30531352-30531374 AGAGACAGGGTTTCACCATGTGG - Intergenic
1124764318 15:32476259-32476281 AGAGACAGGGTTTCACCATGTGG + Intergenic
1124774316 15:32572839-32572861 AGAGACAGGGTTTCACCATGTGG - Intergenic
1125702373 15:41698351-41698373 AGAGACAGGGTTTCACCATGTGG + Intronic
1125968761 15:43894967-43894989 AGAGACAAGGTCTCACCATATGG + Intronic
1127032892 15:54883495-54883517 AGAGAAAAGGTCCCAGCTTTGGG + Intergenic
1127250617 15:57233361-57233383 TGAGACAGGGTCTCATTATGTGG + Intronic
1128652457 15:69428469-69428491 AGAGACAGGGTTTCACCATGTGG - Intronic
1128929738 15:71693459-71693481 ACAGACCAGGTTTCATCATGTGG - Intronic
1129248956 15:74297739-74297761 AGAGGGAAGGTGCCATCATGGGG + Intronic
1130126096 15:81095294-81095316 AGAGACAGGGTCCCACTATGTGG + Intronic
1130274974 15:82471715-82471737 GGAGACAAGGTCTCACTATGTGG - Intergenic
1130467323 15:84199084-84199106 GGAGACAAGGTCTCACTATGTGG - Intergenic
1130496938 15:84474452-84474474 GGAGACAAGGTCTCACTATGTGG + Intergenic
1130533785 15:84768421-84768443 AGAGACAAGGTTTCATCATGTGG + Intronic
1130589618 15:85203682-85203704 GGAGACAAGGTCTCACTATGTGG - Intergenic
1131105004 15:89727538-89727560 AGAGATAAGGTCTCGACATGTGG - Intronic
1131249557 15:90821324-90821346 AGAGACAGGGTTTCACCATGGGG + Intergenic
1131374344 15:91911200-91911222 AGAGACACTGTCTCCTCATGTGG - Intronic
1132460376 16:50706-50728 AGAGACAGGGTTTCACCATGCGG + Intronic
1132782751 16:1637105-1637127 AGAGACAGGGTTTCACCATGTGG - Intronic
1132942762 16:2516292-2516314 AGAGACAGGGTCTCGCCATGTGG + Intronic
1133318419 16:4898190-4898212 AGAGACAGGGTCTCATCATGTGG - Intronic
1133386469 16:5374121-5374143 AGAGACAGGGTTTCACCATGTGG + Intergenic
1133687747 16:8182400-8182422 AGAGACAGGGTTTCACCATGTGG + Intergenic
1134827686 16:17297701-17297723 AGAGACAAGGTCTCACTCTGTGG - Intronic
1135019006 16:18947975-18947997 TGAGACAAGGTCTCATTCTGTGG + Intergenic
1135133452 16:19871096-19871118 AGAGACAGGGTCTCATTATGTGG - Intronic
1135469341 16:22715430-22715452 AGAGACAGGGTTTCACCATGTGG - Intergenic
1135529796 16:23243328-23243350 AGAGATGAGGTCTCACCATGTGG + Intergenic
1135581048 16:23626805-23626827 AGAGACAAGGTTTCACCATTTGG + Intronic
1135667271 16:24346556-24346578 AGAGACAGGGTCTCATTCTGTGG - Intronic
1135730330 16:24889731-24889753 AGAGACAGGGTTTCACCATGTGG + Intronic
1135770547 16:25214875-25214897 AGAGACAGGGTTTCACCATGTGG + Intergenic
1136005548 16:27326638-27326660 AGAGACAGGGTCTCATTCTGTGG - Intronic
1136345744 16:29674587-29674609 AGAGCCCAGGGCCCAGCATGCGG + Intronic
1136492001 16:30614717-30614739 AGAGACAGGGTTTCACCATGTGG - Intronic
1136496158 16:30646018-30646040 ATAGACAAGGTCTCACTATGTGG - Intergenic
1137625944 16:49908662-49908684 GGAGAGAAGGTCAGATCATGTGG + Intergenic
1137638392 16:50007386-50007408 AGAGACAAGGTTTCACCATCTGG - Intergenic
1137980961 16:53069188-53069210 AGAGACAAGGTTTCACCATGTGG + Intronic
1138048260 16:53748949-53748971 AGAGACGAGGTTTCACCATGTGG + Intronic
1138562749 16:57811728-57811750 AGAGACAGGGTTTCACCATGTGG - Intronic
1138797309 16:59984947-59984969 AGAGACAGGGTTTCACCATGTGG - Intergenic
1139015336 16:62683626-62683648 AGAGACATGGTTTCACCATGTGG + Intergenic
1139674412 16:68513218-68513240 AGAGACATGGTTCCACCTTGAGG - Intergenic
1139734364 16:68974474-68974496 AGAGACAGGGTTTCACCATGTGG - Intronic
1140783294 16:78316058-78316080 AGAGACAGGGTTTCACCATGTGG - Intronic
1141224416 16:82101513-82101535 AGAATCAAGGTGCCAGCATGTGG + Intergenic
1141468017 16:84219850-84219872 AGAGACAAGGTTTCACCATGTGG - Exonic
1141836709 16:86545484-86545506 AGAGCCCAAGTCCCATCATCTGG + Intronic
1142006360 16:87691235-87691257 AGAGTGAAGGTCCCTTCAAGGGG - Intronic
1142333529 16:89471597-89471619 AGAGAGGAGGTTTCATCATGTGG - Intronic
1142334310 16:89477540-89477562 AGAGACAGGGTTTCACCATGTGG + Intronic
1142424370 16:89993228-89993250 AGAGACAAGGTTTCACCATATGG - Intergenic
1142991702 17:3735496-3735518 AGAGACAGGGTCTCGCCATGTGG + Intronic
1143090192 17:4445560-4445582 AGAGACAGGGTTTCACCATGTGG + Intronic
1143167945 17:4907854-4907876 AGAGACAGGGTTTCACCATGTGG - Intergenic
1143191650 17:5044358-5044380 AGAGACAGGGTCTCACTATGTGG + Intronic
1143605930 17:7985842-7985864 AGAGACAAGGTCTCAAGGTGGGG - Intergenic
1143738452 17:8932418-8932440 AGAGACAGGGTTTCACCATGTGG + Intronic
1143993925 17:10990513-10990535 AGAGACAAAGTCCCCTCACCTGG - Intergenic
1144466961 17:15504719-15504741 AGAGACAAGGTCTCACTATTTGG + Intronic
1145024817 17:19460287-19460309 AGAGACAGGGTCTCCCCATGTGG + Intergenic
1145224463 17:21116501-21116523 AGAGACGGGGTCTCACCATGTGG - Intergenic
1145322090 17:21772664-21772686 AGAGACAAGGGTCCCTCAAGGGG + Intergenic
1146982234 17:37174716-37174738 AGAGACAGGGTTTCACCATGTGG + Intronic
1147152357 17:38525123-38525145 AGAGACGAGGTTTCACCATGTGG - Intergenic
1147342725 17:39764038-39764060 AGAGACAGGGTTTCACCATGTGG + Intergenic
1147502903 17:40982816-40982838 AGAGACAGGGTTTCACCATGTGG - Intronic
1147594804 17:41710017-41710039 TCAGACGAGGTCCCCTCATGAGG + Intergenic
1147682599 17:42261092-42261114 AGAGACAGGGTCTCACCAAGCGG + Intronic
1148273504 17:46282605-46282627 AGAGACAAGGTCTCATACTGTGG + Intronic
1148597699 17:48870071-48870093 AGAGACAAGGCTCCATCCCGAGG + Intergenic
1148607563 17:48941874-48941896 GGAGACAGGGTTTCATCATGTGG + Intronic
1148714513 17:49706440-49706462 ACAGACAAGTTCCTTTCATGTGG - Intronic
1148877064 17:50695182-50695204 AGAGACAGGGTCTCACTATGTGG - Exonic
1149480908 17:57002392-57002414 AGAGACAAGGTTTCTCCATGTGG - Intronic
1149677478 17:58478674-58478696 AGAGACAGGGTTTCACCATGTGG - Intronic
1149814080 17:59706363-59706385 AGAGACAGGGTCTCACTATGTGG + Intronic
1149942001 17:60880473-60880495 AGAGACAGGGTTTCACCATGTGG + Intronic
1150047859 17:61930929-61930951 AGAGACAGGGTTTCATTATGTGG + Intergenic
1150355120 17:64476492-64476514 AGAGACAGGGTCTCACTATGTGG - Intergenic
1150370981 17:64637747-64637769 AGAGACAGGGTTTCACCATGTGG + Intronic
1150409558 17:64931972-64931994 AGAGACAAGGTCTCATATTGTGG - Intergenic
1150654201 17:67029144-67029166 AGAGACAGGGTTTCACCATGTGG - Intronic
1150683219 17:67299947-67299969 AGAGACAGGGTTTCACCATGTGG - Intergenic
1150801427 17:68286076-68286098 AGAGACAGGGTCTCACCATGTGG + Intronic
1151291762 17:73155741-73155763 AGTGGCCAGGTCCCATCACGAGG + Intergenic
1151301364 17:73229678-73229700 AGAGACAGGGTTTCACCATGTGG - Intronic
1151304300 17:73253172-73253194 AGAGACAGGGTCTCACCATGTGG - Intronic
1151500676 17:74486375-74486397 AGAGACAGGGTTTCATCATGTGG + Intergenic
1151501779 17:74494680-74494702 ACAGACAGGGTCTCACCATGTGG + Intergenic
1151884342 17:76914821-76914843 AGAGACAGGGTTTCACCATGTGG + Intronic
1152205173 17:78970742-78970764 AGAGACAGGGTTTCACCATGTGG - Intergenic
1152429413 17:80239693-80239715 AGAGACAAGGTCTCACTTTGTGG + Intronic
1152590750 17:81210714-81210736 AGACCCGAGGTCCCATCCTGTGG - Intronic
1152975415 18:212416-212438 AGAGACAGGGTTTCACCATGTGG - Exonic
1153634770 18:7104162-7104184 AGAGACAGGGTTTCACCATGTGG + Intronic
1153670924 18:7411454-7411476 AGAGACAGGGTTTCACCATGTGG + Intergenic
1153979452 18:10296788-10296810 AGAGACAGGGTTTCACCATGTGG - Intergenic
1154102596 18:11489854-11489876 AGAACCTAGGTCCCTTCATGGGG + Intergenic
1154150129 18:11900024-11900046 AGAGACAGGGTTTCACCATGTGG - Intronic
1154168294 18:12032602-12032624 AGAGACAGGGTCTCATTCTGTGG - Intergenic
1155005172 18:21722554-21722576 AGAGACAGGGTTTCACCATGTGG + Intronic
1157024089 18:43822143-43822165 AGACTCAAGGTCTCATCAAGGGG + Intergenic
1157024884 18:43830800-43830822 AGAGAAAACCTCCCATCCTGAGG - Intergenic
1157171069 18:45405709-45405731 AGAGACAGGGTTTCACCATGAGG - Intronic
1158069518 18:53454160-53454182 AGAGATAAGGTCTCACTATGTGG - Intronic
1158474142 18:57765080-57765102 AGAGACAAGGAACTATCATTTGG + Intronic
1158781231 18:60654478-60654500 TGACACAAGGACACATCATGAGG - Intergenic
1159048935 18:63398647-63398669 AGAGACGAGATTTCATCATGTGG - Intronic
1159057931 18:63484924-63484946 AGAGACAGGGTTTCACCATGTGG + Intronic
1159139577 18:64376885-64376907 AGAGACAGGGTTTCACCATGGGG + Intergenic
1159960684 18:74553874-74553896 GCAGACCATGTCCCATCATGGGG - Intronic
1160544722 18:79645358-79645380 AGAGAGAAAGTGCCTTCATGGGG + Intergenic
1161004303 19:1926819-1926841 AGAGACAGGGTTTCACCATGTGG - Intergenic
1161082523 19:2318402-2318424 AGAGACAAGGTCTCACTCTGTGG - Intronic
1161180313 19:2876402-2876424 AGAGACAAGGTTTCACCATATGG - Intronic
1162171490 19:8792881-8792903 AGAGACAAGGTCTCACTTTGTGG + Intergenic
1162330973 19:10029437-10029459 AAAGACAAGGTCCGATCAAGAGG + Intergenic
1162463694 19:10828736-10828758 AGAGATAGGGTTCCACCATGTGG - Intronic
1162505968 19:11085309-11085331 AGAGACAGGGTCTCACTATGTGG + Intergenic
1162610441 19:11745949-11745971 AGAGACAAGGTCTCACTATGTGG - Intergenic
1162720916 19:12662288-12662310 AGAGATAAGGTCTCACCATGTGG - Intronic
1163030489 19:14541009-14541031 AGAGACAGGGTTTCACCATGTGG + Intronic
1163859838 19:19736734-19736756 AGAGACGAGGTTTCACCATGTGG + Intergenic
1164119319 19:22251600-22251622 AGAGACAGGGTTTCACCATGTGG - Intergenic
1164138932 19:22440188-22440210 AGAGACAGGGTTTCACCATGTGG + Intronic
1164225683 19:23243735-23243757 AGAGACGAGGTTTCATCATGTGG - Intronic
1164524586 19:29003963-29003985 AGAGTGAAGGTCCCACCATGTGG - Intergenic
1164637657 19:29803053-29803075 AGAGACAGGGTCTCACCCTGTGG + Intergenic
1164823942 19:31270494-31270516 AGAGACAGGGTCTCACTATGTGG + Intergenic
1165340851 19:35211135-35211157 AGAGACAGGGTCTCACTATGTGG - Intergenic
1165581626 19:36869964-36869986 AGAGACAGGGTTTCACCATGTGG + Intronic
1165957386 19:39509754-39509776 AGAGACAGGGTTTCACCATGTGG - Intergenic
1166215107 19:41329803-41329825 AGAGACAGGGTTTCACCATGTGG + Intronic
1166972085 19:46575752-46575774 AGAGACAAGGTCCCATCATGTGG - Intronic
1167103028 19:47415757-47415779 AGAGACAGGGTTTCATCATTTGG + Intronic
1167304402 19:48698759-48698781 AGAGACAAGTTCTCACTATGTGG + Intronic
1167398106 19:49244953-49244975 AGAGACAGGGTTTCACCATGTGG + Intergenic
1167445047 19:49532859-49532881 AGAGACAAGGTTTCACCATGTGG + Intronic
1167795556 19:51705880-51705902 AGAGACAGGGTTTCACCATGTGG + Intergenic
1167995661 19:53399998-53400020 AGAGACAGGGTTTCACCATGTGG + Intronic
1168049156 19:53815795-53815817 AGAGACAGGGTTTCACCATGTGG + Intronic
1168068568 19:53935506-53935528 AGAGACAAGGTTTCACCATGTGG + Intronic
926017249 2:9464775-9464797 AGAGACAGGGTTTCACCATGTGG + Intronic
927466631 2:23341599-23341621 AGAGACAACCTCCCATTATGGGG + Intergenic
927985497 2:27407860-27407882 AGAGACAGGGTTTCTTCATGTGG - Intronic
928088044 2:28357954-28357976 AGAGACAGGGTTTCACCATGTGG + Intergenic
928591927 2:32826099-32826121 AGAACCAAGTTCCCATCATTAGG + Intergenic
928603019 2:32920017-32920039 AGAGACAGGGTTTCACCATGTGG + Intergenic
928975981 2:37087022-37087044 TCAGACAAGATCCCTTCATGGGG + Intronic
929187811 2:39113381-39113403 AGAGACAGGGTCTCACTATGTGG + Intronic
929289174 2:40169753-40169775 AGAGACGGGGTCTCACCATGTGG - Intronic
929446931 2:42009225-42009247 AGAGACAAGGCCCCTTTTTGGGG + Intergenic
930767952 2:55104240-55104262 AGAGACAGGGTTTCACCATGTGG + Intronic
931364564 2:61607921-61607943 AGAGACAGCATCTCATCATGTGG - Intergenic
931466360 2:62490889-62490911 AGAGACAGGGTCTCACCATGTGG - Intergenic
932140301 2:69271085-69271107 AGGGACAATGTCCAATGATGGGG + Intergenic
932141628 2:69283590-69283612 AGAGACAGGGTTTCACCATGTGG - Intergenic
932602502 2:73137957-73137979 AGAGACATGGTTTCACCATGTGG + Intronic
933311080 2:80662060-80662082 AGAGACAGGGTTTCATCATGTGG - Intergenic
933554539 2:83815648-83815670 AGAGACGGGGTTTCATCATGTGG - Intergenic
933891938 2:86780193-86780215 AGAGCCAAGGTCCTGTAATGAGG + Intergenic
934733660 2:96675746-96675768 GGAGACAGGGTCTCACCATGTGG + Intergenic
935886331 2:107623629-107623651 AGAGACACGTTTTCATCATGTGG - Intergenic
936121516 2:109749908-109749930 ACTGACAAGGTCACATAATGTGG + Intergenic
936223181 2:110621560-110621582 ACTGACAAGGTCACATAATGTGG - Intergenic
936455173 2:112667599-112667621 AGAGACAGGGTTTCACCATGTGG + Intergenic
938014446 2:127856095-127856117 GGAGACAAGGTTTCACCATGTGG - Intronic
938050842 2:128169349-128169371 AGAGACAAGGTCTCACTCTGTGG - Intronic
939517292 2:143184866-143184888 AGAGACAAAGTCTCACTATGTGG + Intronic
939914849 2:148026601-148026623 AGAGACAAGGTCCCGCTCTGTGG - Intronic
939999272 2:148950621-148950643 AGAGACAGGGTTTCACCATGTGG - Intronic
941098608 2:161271964-161271986 AGAGACAGGGTATCATCATGTGG - Intergenic
941183172 2:162286226-162286248 ATAGACAAGGCAGCATCATGTGG - Intronic
941890699 2:170578214-170578236 ACAGACAAGGTCGCAGCCTGCGG + Intronic
941965573 2:171297144-171297166 AGAGACAGGGTCTCCTTATGTGG - Intergenic
941970160 2:171341422-171341444 AGAGACAGGGTTTCACCATGTGG + Intronic
942955206 2:181765157-181765179 AGAGACAAGGTTTCACCATATGG - Intergenic
942963720 2:181864012-181864034 AGAGACAGGGTCCCACTATGTGG + Intergenic
942985081 2:182131544-182131566 AGAGACAGGGTTTCACCATGTGG - Intergenic
943104013 2:183520589-183520611 AGAGTCAAGATCTCATCATATGG - Intergenic
943754433 2:191543099-191543121 AGAGACAGGGTTTCATCATGTGG + Intergenic
943875511 2:193062215-193062237 AGAGACAGGGTCTCATTATGTGG - Intergenic
944539457 2:200742162-200742184 AGTCACAGGGTCCCATCATGGGG - Intergenic
944586369 2:201177354-201177376 AGAGACAGGGTTTCATCATTTGG + Intergenic
946004478 2:216511556-216511578 AGAGACAGGGTTTCACCATGTGG + Intronic
946149995 2:217757962-217757984 AAAGACACAGTCCAATCATGGGG - Intergenic
946362411 2:219227329-219227351 AGAGACAGGGTTTCACCATGTGG - Intronic
946960315 2:224978245-224978267 AGAGACGAGGTATCACCATGTGG - Intronic
947436100 2:230073610-230073632 AGAGACAGGGTTTCATCATGTGG - Intergenic
947797614 2:232904921-232904943 AGAGACAAGGTCTCACTCTGTGG - Intronic
949034768 2:241811379-241811401 AGAGACAAGGGCCCACTGTGCGG - Exonic
1169050992 20:2577725-2577747 AGAGACAGGGTCTCACCATGCGG - Intronic
1170725367 20:18921351-18921373 AGAGACAGGGTTTCACCATGTGG + Intergenic
1172047627 20:32091784-32091806 AGAGAAGAGGTCCCACTATGTGG - Intronic
1172155831 20:32823701-32823723 AGAGACCAGGTCTCATTTTGCGG - Intronic
1172162067 20:32875692-32875714 AGAGACAGGGTTTCACCATGTGG + Intronic
1172171146 20:32933791-32933813 AGGGACAAGGTTTCACCATGTGG - Intronic
1172191668 20:33065489-33065511 TGAGACAAGGTCTCATTCTGTGG - Intronic
1173731953 20:45335363-45335385 AGAGACAAGTTCTCACCATGTGG + Intronic
1174600610 20:51721432-51721454 AGAGACAGGATCTCATTATGTGG - Intronic
1174624611 20:51903793-51903815 AGAGACAGGGTTTCACCATGTGG - Intergenic
1174807960 20:53620971-53620993 AGAGACAGGGTTTCACCATGAGG + Intergenic
1175887283 20:62299407-62299429 AGAGACAGGGTTTCACCATGTGG - Intergenic
1177405071 21:20656368-20656390 AGAGACTAGGTTTCACCATGTGG + Intergenic
1177710346 21:24765619-24765641 AGAGACAGGGTTTCACCATGTGG - Intergenic
1178315750 21:31565467-31565489 AGAGACGAGGTTTCACCATGTGG + Intergenic
1178929936 21:36809026-36809048 AGAGACAGGGTCTCACCATGTGG - Intronic
1179794178 21:43773040-43773062 AGAGACAGGGTTTCACCATGTGG + Exonic
1180607921 22:17075253-17075275 AGAGACAGGGTTTCACCATGTGG - Intergenic
1181752570 22:24999414-24999436 AAAGACAGGGTCTCATCATATGG + Intronic
1182291513 22:29283717-29283739 AGAGACAGGGTTTCACCATGTGG + Intronic
1182533404 22:30980754-30980776 AGAGACGGGGTTTCATCATGTGG - Intergenic
1182625210 22:31640764-31640786 AGAGACAAGGTTTCACCATGTGG + Intronic
1183155249 22:36069850-36069872 AGAGACAAGGTTTCATCATGTGG - Intergenic
1183391533 22:37547986-37548008 AGAGACAGGGTTTCACCATGTGG + Intergenic
1183566534 22:38619507-38619529 AGAGACGAGGTTTCACCATGTGG + Intronic
1184008449 22:41728537-41728559 AGAGACAAGGTCTCAGTATATGG - Intronic
1184329535 22:43818398-43818420 AGAGACAGGGTTTCACCATGTGG - Intergenic
1184363823 22:44036069-44036091 AGAGACAAGGTTTCACCATTTGG - Intronic
1184469600 22:44688800-44688822 AGAGACAGGGTTTCACCATGTGG - Intronic
1185357035 22:50379692-50379714 AGAGACAAGGTCTCCCTATGTGG - Intronic
949505406 3:4722961-4722983 AGAGACATGGTTTCACCATGTGG - Intronic
949553362 3:5131096-5131118 AGAGACGAGGTTTCACCATGTGG + Intronic
951258839 3:20482453-20482475 AAAGACAAGATCCACTCATGTGG - Intergenic
952034294 3:29180766-29180788 AGAGACAAGGTACAATCAGAAGG + Intergenic
952059924 3:29495603-29495625 AGAGACAAGGTTTCACCATGTGG + Intronic
952403558 3:32985475-32985497 AGAGACAGGGTGTCACCATGTGG + Intergenic
953100809 3:39824901-39824923 AGAGACAAGGTCCAACTATGTGG + Intronic
953753015 3:45623838-45623860 AGAGACAGGGTCCCGTTTTGGGG - Intronic
954082285 3:48219688-48219710 AGAGCCCAGGTTCCCTCATGAGG - Intergenic
954084266 3:48231548-48231570 AGAGACAGGGTTCCACCACGTGG - Intergenic
954256075 3:49407418-49407440 AGAGACAGGGTTTCACCATGTGG + Intronic
954465867 3:50654430-50654452 TGAGTCAAGGTCCCATCACCTGG - Intergenic
954814735 3:53271637-53271659 AGAGACAAGCTTTCACCATGTGG + Intergenic
956286922 3:67620397-67620419 AGAGACAAGGTTTCACCATGTGG - Intronic
957760222 3:84546691-84546713 AGAGACAAGATCCAACCATTTGG - Intergenic
959048841 3:101504831-101504853 AGAGACAGGGTCTCACCATGTGG - Intronic
959271791 3:104220989-104221011 AGAGACAGGGTTTCACCATGTGG + Intergenic
960110219 3:113838384-113838406 AGAGACAAGGTTTCACCATGTGG - Intronic
960196051 3:114769871-114769893 AGAGACAGGGTTTCACCATGTGG - Intronic
960331879 3:116369863-116369885 AGAGAAACGGTCACATGATGAGG + Intronic
960537074 3:118826285-118826307 AGAGAAAAGGGCCCATAAGGAGG - Intergenic
960790698 3:121427174-121427196 AGAATCAAGGTCTAATCATGAGG + Intergenic
960851837 3:122063741-122063763 AGAGACACAGTTTCATCATGGGG + Intronic
960895535 3:122500689-122500711 AGAGATAGGGTCTCACCATGTGG + Intronic
960936205 3:122904464-122904486 AGAGGCAGGGTTTCATCATGTGG + Intergenic
961504149 3:127359124-127359146 AGAGACAGGGTTTCACCATGTGG - Intergenic
962629655 3:137263401-137263423 TGAGCCAAGTTCCCATCATTTGG + Intergenic
962777940 3:138681229-138681251 AGAGACAGGGTTTCACCATGTGG + Intronic
962801196 3:138892084-138892106 AGAGACAGGGTTTCACCATGTGG - Intergenic
963145391 3:141988846-141988868 AGAGACAGGGTTTCACCATGTGG + Intronic
963146748 3:142002178-142002200 AGAGACAGGGTTTCACCATGTGG + Intronic
963837441 3:150071308-150071330 AGAGAGAAGCTCTTATCATGGGG + Intergenic
965630122 3:170724566-170724588 AGACACAATATCCCAGCATGAGG + Intronic
966033016 3:175374366-175374388 AGAGACAAGGTCTCACCATGTGG - Intronic
966803055 3:183782607-183782629 AGAGACAGGGTTTCACCATGTGG + Intronic
967183137 3:186923690-186923712 AGAGACAGGGTTTCACCATGTGG - Intergenic
967295981 3:187965544-187965566 AGAGACAGGGTTTCACCATGTGG - Intergenic
967551972 3:190806905-190806927 AGAGACGGGGTTTCATCATGTGG + Intergenic
967656181 3:192052658-192052680 AGAGACAGGGTTTCACCATGTGG - Intergenic
968144048 3:196283150-196283172 AGAGACGGGGTTTCATCATGTGG - Intronic
968145859 3:196298497-196298519 AGAGACAGGGTTTCACCATGTGG + Intronic
968200779 3:196753142-196753164 AGAGACGAGGTTTCATCATGTGG + Intronic
968694035 4:2012456-2012478 AGAGACAGAGTCCCACCATGTGG - Intronic
968772891 4:2519580-2519602 AGAGACAGGGTCTCACTATGTGG - Intronic
969401353 4:6957724-6957746 AGAAACAGGGTCTCACCATGTGG - Intronic
971273007 4:25168847-25168869 AGAGACAGGGTTTCACCATGTGG - Intronic
971355233 4:25889409-25889431 AGAGACAGGGTCTCAATATGTGG + Intronic
972436143 4:39037286-39037308 AGAGACGGGGTTTCATCATGTGG + Intergenic
972924541 4:43986877-43986899 AGAGACAGGGTTTCACCATGTGG + Intergenic
974229058 4:59085683-59085705 AGAGACATGGTTTCACCATGTGG + Intergenic
974281296 4:59797647-59797669 AGAGACAGGGTTTCACCATGTGG + Intergenic
975686518 4:76921243-76921265 AGAGACAAGGTCTCACTTTGTGG + Intergenic
975876962 4:78852622-78852644 AGAGACAAGGTCTCATTCTGTGG + Intronic
976677804 4:87722806-87722828 AGAGACTAGCTCCCTTTATGTGG + Intergenic
977563160 4:98553879-98553901 AGAGACAGGGTTTCGTCATGTGG - Intronic
978386389 4:108179773-108179795 AGAGACAGGGTTTCATCATATGG - Intergenic
979372549 4:119906914-119906936 AGAGACAGGGTTTCACCATGTGG + Intergenic
982261353 4:153496878-153496900 TGAGACAGGGTCTCATTATGTGG + Intronic
982694189 4:158580973-158580995 AGAGACAGGGTTTCACCATGTGG + Intronic
983549844 4:169006313-169006335 AGAGACGAGGTCACACTATGTGG - Intronic
983557912 4:169074886-169074908 GGAGACAAGGTCTCACTATGTGG - Intergenic
983934840 4:173494462-173494484 AGAGACAATGTGCCAACACGGGG + Intergenic
984997823 4:185453180-185453202 AGAGACAGGGTCTCACCATGTGG - Intronic
985131866 4:186746577-186746599 AGAGACCAGGTTTCACCATGGGG + Intergenic
985336017 4:188895708-188895730 AGAGACAGGGTTTCACCATGTGG - Intergenic
985550239 5:528988-529010 AGAGACAGGGTCTCACTATGTGG - Intergenic
985714463 5:1447495-1447517 CGAGACAGGGTCTCATCCTGTGG - Intergenic
986135721 5:4975646-4975668 AGAGACAAGGTTTCACCATGTGG - Intergenic
987337437 5:16909318-16909340 AGAGGCAAGGTTTCACCATGTGG - Intronic
989054513 5:37354329-37354351 AGAGACACGGTTTCACCATGTGG + Intronic
990057276 5:51598899-51598921 AGAGACAGGGTTTCACCATGTGG + Intergenic
990201903 5:53385474-53385496 AGAGACAAGGTCTCACTCTGTGG + Intergenic
990790361 5:59471054-59471076 AGAGACAGGGTCTCAATATGTGG - Intronic
991114354 5:62936929-62936951 GGAGACAACGACCCATGATGTGG + Intergenic
991533100 5:67637178-67637200 AGAGAGAAGTTTCCATCATCTGG - Intergenic
992047527 5:72909164-72909186 CAAAACAAGGCCCCATCATGTGG - Exonic
992712413 5:79472587-79472609 AGAGACAAGGTCTCACTACGTGG - Intronic
992837993 5:80659046-80659068 AGAGACAGGGTTTCACCATGTGG - Intronic
992842711 5:80711837-80711859 AGAGACAGGGTTTCACCATGTGG + Intronic
993106513 5:83606504-83606526 AGAGACAGGGTTTCACCATGTGG - Intergenic
993388907 5:87294189-87294211 AGAGACAGGGTCTCACTATGTGG + Intronic
993633451 5:90315717-90315739 AGAGACAGGGTTTCACCATGTGG + Intergenic
993897768 5:93558505-93558527 AGAGACAGGGTTTCACCATGTGG + Intergenic
995083283 5:108079032-108079054 AGAGACAGGGTCTCACTATGTGG + Intronic
995437129 5:112149282-112149304 AGAGACAGTGTTTCATCATGTGG - Intronic
995507545 5:112875551-112875573 AGAGGCAGGGTCTCACCATGTGG + Intronic
995578233 5:113564997-113565019 AGAGACAGGGTTTCACCATGTGG + Intronic
997316750 5:132942904-132942926 AGAGACTGGGTCTCATCATGTGG - Intronic
997545750 5:134706071-134706093 AGAGACAGGGTTTCTTCATGTGG + Intronic
998305370 5:141070817-141070839 AGAGACAGGGTTTCACCATGTGG + Intergenic
998475505 5:142417778-142417800 AGAGACAGGGTTTCACCATGTGG + Intergenic
1000080600 5:157841814-157841836 AGAGACAGGGTCTTATTATGTGG + Intronic
1000095042 5:157964302-157964324 AGAGACAGGGTTTCACCATGTGG - Intergenic
1000186187 5:158860494-158860516 AGAGACAAGCCACCACCATGTGG + Intronic
1000255498 5:159534616-159534638 AGAGACAGGGTCCCACTGTGTGG + Intergenic
1001330459 5:170758903-170758925 AGAGACAGGGTTTCACCATGTGG + Intergenic
1001564944 5:172693888-172693910 AGAGACGAGGTTTCACCATGTGG - Intergenic
1001613474 5:173022816-173022838 AGAGACAAGGTCTTACTATGTGG + Intronic
1002140912 5:177138439-177138461 AGAGACGAGGTTTCACCATGTGG + Intronic
1004140993 6:13016999-13017021 AGAGACAGGGTTTCATCCTGTGG - Intronic
1004239447 6:13906356-13906378 AGAGACAGGGTTTCACCATGTGG - Intergenic
1004270156 6:14188114-14188136 AGAGACAGGGTCTCACTATGTGG + Intergenic
1004341553 6:14812534-14812556 AGAGATGGGGTCCCATTATGTGG + Intergenic
1004398943 6:15270760-15270782 AGAGACAGGGTTTCACCATGTGG - Intronic
1004696172 6:18035245-18035267 AGAGACAGGGTTTCACCATGTGG - Intergenic
1004780434 6:18902717-18902739 AGAGACAGGGTCTCACTATGTGG + Intergenic
1004892474 6:20114695-20114717 AGAGACGAGGTTTCACCATGTGG - Intronic
1004984573 6:21066809-21066831 AGAGACAGGGTCCTACTATGTGG + Intronic
1005098073 6:22140451-22140473 TAACACAAGGTCCCATCATGTGG - Intergenic
1005974491 6:30787637-30787659 AGAGACAGGGTTTCACCATGTGG - Intergenic
1006279048 6:33032360-33032382 AGAGATAGGATCTCATCATGTGG + Intergenic
1006593836 6:35178263-35178285 AGAAACAAGGTCCCTGCATCTGG + Intergenic
1007153526 6:39719131-39719153 AGAGACAGGGTTTCACCATGTGG - Intronic
1007324693 6:41051059-41051081 AGAGACAGGGTTTCACCATGTGG - Intronic
1007811818 6:44491689-44491711 AGTGACCAGCTCCCATCCTGAGG - Intergenic
1008355897 6:50552691-50552713 GGACATATGGTCCCATCATGGGG + Intergenic
1009609403 6:65920921-65920943 AGAGAGAAGGTACCATCCTCAGG - Intergenic
1010812978 6:80321463-80321485 ATTGACAAGTTGCCATCATGTGG + Intronic
1010937302 6:81877566-81877588 AGAGACAGGGTCTCACTATGTGG - Intergenic
1011583783 6:88902208-88902230 AAATAAAAGGTCTCATCATGGGG + Intronic
1011614183 6:89182854-89182876 AGAGACAGGGTCTCATTCTGTGG - Intronic
1013195961 6:107845832-107845854 AGAAACAAGGGCCCAGCATCTGG - Intergenic
1013212372 6:107998675-107998697 AGAGACAAGGTTTCACCATGTGG - Intergenic
1014113141 6:117643711-117643733 AGAGACAGGGTTTCATCATGTGG - Intergenic
1014623783 6:123701325-123701347 AGAGACAGGGTTTCACCATGTGG + Intergenic
1014790193 6:125663743-125663765 AGAGACGAGGTTTCACCATGTGG + Intergenic
1015586968 6:134786333-134786355 AGAGACGAGGTTTCACCATGTGG + Intergenic
1015645501 6:135383420-135383442 AGAGACAGGGTCCCACTGTGTGG + Intronic
1016268308 6:142257821-142257843 AGAGACAGGGTTTCACCATGTGG - Intergenic
1017257705 6:152352587-152352609 AGAGACAGGGTTTCACCATGTGG + Intronic
1017467354 6:154706893-154706915 AGAGACAGGGTCTCACTATGTGG + Intergenic
1018476140 6:164144270-164144292 AGAAACAAGGTAGAATCATGAGG - Intergenic
1019201437 6:170319480-170319502 AGAGACAGGGTTTCACCATGTGG - Intronic
1019270159 7:142488-142510 AGGGACCAGGTCCCATGCTGTGG - Intergenic
1019311434 7:363431-363453 AGAGACAGGGTCTCACTATGTGG + Intergenic
1020024552 7:4889714-4889736 AGAGACAGGGTTTCACCATGTGG - Intergenic
1020057613 7:5128763-5128785 AGAGACAGGGTTTCACCATGAGG + Intergenic
1020396335 7:7722719-7722741 AGACACAAGCTCTTATCATGTGG + Intronic
1020956616 7:14746682-14746704 AGAGACAGGGTTTCACCATGTGG + Intronic
1022978895 7:35584452-35584474 AGAGACAGGGTCCCACTCTGTGG - Intergenic
1023423663 7:40011335-40011357 AGAGACAGGGTCTCACTATGTGG - Intronic
1023809920 7:43904159-43904181 CGGGACCAGGTCCCATCATCTGG + Intronic
1024109860 7:46134132-46134154 AGACACCAGATCCCTTCATGTGG + Intergenic
1024141845 7:46469704-46469726 AGAGACAGGGTTTCACCATGTGG - Intergenic
1024298314 7:47863834-47863856 AGAGACAAGGTCTCACTGTGTGG - Intronic
1024603117 7:51003270-51003292 AGAGACGAGGTTTCACCATGTGG + Intergenic
1025097211 7:56105588-56105610 AGAGACAGGGTCTCATTATGTGG - Intronic
1025608688 7:63057924-63057946 AGAGACAGGGTTTCACCATGTGG + Intergenic
1026056343 7:66987341-66987363 AGAGACAGGGTTTCACCATGTGG + Intergenic
1026077727 7:67188132-67188154 AGAGACAGGGTTTCACCATGTGG - Intronic
1026175421 7:67992256-67992278 AGAGACAAGTTTTCACCATGTGG - Intergenic
1026242943 7:68592965-68592987 AGAGACGAGGTTTCACCATGTGG + Intergenic
1026556253 7:71411304-71411326 AGAGATAAGGTCACACCATGTGG + Intronic
1026699124 7:72623985-72624007 AGAGACAGGGTTTCACCATGTGG + Intronic
1026813993 7:73494557-73494579 AGAGACAGGGTCTCACCATGTGG - Intronic
1026994787 7:74608399-74608421 AGAGACAAGGTCTCTTTGTGTGG + Intergenic
1027364549 7:77443952-77443974 ACAGACAAGGTTTCACCATGTGG - Intergenic
1027751958 7:82160657-82160679 AGAGACAAGGTCTCCTTACGTGG + Intronic
1028545908 7:91999409-91999431 AGAGACAGGGTTTCACCATGAGG + Intronic
1029164262 7:98575538-98575560 AGAGACAAGGTCTCATAATGTGG + Intergenic
1029174743 7:98656621-98656643 AGAGACAGGGTTTCACCATGTGG - Intergenic
1029552754 7:101246336-101246358 AGAGACAGGGTCTCATTCTGTGG + Intronic
1029676931 7:102076194-102076216 AGAGACGAGGTTTCACCATGTGG - Intronic
1029733176 7:102451013-102451035 AGAGACAGGGTTTCACCATGTGG - Exonic
1031237443 7:119195127-119195149 AGAGACAGGGTTTCACCATGTGG - Intergenic
1031326354 7:120403514-120403536 AGAGGCAGGGTCTCATCATGTGG + Intronic
1031427925 7:121630220-121630242 AGAGACAGGGTTTCACCATGTGG - Intergenic
1031989205 7:128185948-128185970 AGAGACGAGGTTTCACCATGTGG - Intergenic
1033396535 7:140979355-140979377 AGAGACAGGGTTTCATCATTTGG - Intergenic
1033640872 7:143262596-143262618 AGAGACAGGGTTTCACCATGTGG + Intronic
1033982900 7:147187872-147187894 AGAGACAGGGTTTCACCATGTGG - Intronic
1035175574 7:157047594-157047616 AGAGACAGGGTCTCACCATGTGG - Intergenic
1035704674 8:1666493-1666515 AGAGACAGGGTTTCACCATGTGG - Intronic
1035745854 8:1961751-1961773 AAAGACACGATCCCATCGTGAGG + Intergenic
1036405404 8:8450445-8450467 AGAGACAGGGTTTCATCATTTGG - Intergenic
1036550157 8:9808630-9808652 AGACACAAGGTCCCAGTAAGAGG - Intergenic
1036965344 8:13291092-13291114 AGAGACAGGGTTTCACCATGTGG + Intronic
1037174767 8:15933536-15933558 AGAGGCAAGGTCCATTCATATGG + Intergenic
1037195757 8:16187174-16187196 AGAGACAGGGTTTCATCATTGGG - Intronic
1037325227 8:17682328-17682350 AGAGACAGGGTTTCACCATGTGG - Intronic
1038268951 8:26059856-26059878 AGAGACAGGGTTTCACCATGTGG - Intergenic
1038694381 8:29793156-29793178 AGAGACGGGGTTTCATCATGTGG + Intergenic
1038741977 8:30224295-30224317 AGAGACAGGGTCTCACCATGTGG + Intergenic
1038764141 8:30411795-30411817 AGAGACAGGGTTTCACCATGTGG - Intronic
1038879267 8:31589726-31589748 AGAGACAGGGTCTCACTATGTGG - Intergenic
1039469132 8:37802768-37802790 AGAGTCAGGGTCCCATCCTAGGG + Intronic
1039523113 8:38189128-38189150 AGAGACGAGGTTTCACCATGTGG + Intronic
1039572290 8:38597030-38597052 AGAGACAGGGTTTCACCATGTGG + Intergenic
1039866907 8:41512800-41512822 AGAGACAGGGTTTCACCATGTGG + Intergenic
1040419837 8:47228595-47228617 AGAGACGAGGTTTCACCATGAGG + Intergenic
1040691738 8:49947112-49947134 AGAGACAGGGTTTCACCATGTGG - Intronic
1042324751 8:67516980-67517002 AGAGACAGGGTTTCACCATGTGG + Intronic
1043878257 8:85510802-85510824 AGAGACAGGGTTTCACCATGTGG - Intergenic
1044372056 8:91423540-91423562 AGAGACAGGGTTTCACCATGTGG - Intergenic
1044565531 8:93658135-93658157 AGAGACAGGGTCTTATTATGTGG + Intergenic
1045087965 8:98707951-98707973 AGAGACGAGGTTTCACCATGTGG - Intronic
1045247101 8:100452144-100452166 AGAGTCATGGTCCCATCATCAGG + Intergenic
1045525642 8:102939413-102939435 AGAGACAGGGTTTCACCATGTGG - Intronic
1045756355 8:105547355-105547377 AGAGACAGGGTTTCACCATGTGG - Intronic
1046519022 8:115301145-115301167 AGAGACAGGGTTTCACCATGTGG - Intergenic
1046655194 8:116886112-116886134 AGAGACAGGGTTTCACCATGTGG - Intergenic
1046771717 8:118123238-118123260 AGAGACAGGGTTTCACCATGTGG + Intergenic
1046861383 8:119095514-119095536 AGAGACGGGGTTTCATCATGTGG - Intronic
1046933880 8:119868101-119868123 AGAGACAAGGTTTCACCATGTGG - Intergenic
1046956357 8:120066548-120066570 AGAGACATGGTTTCACCATGTGG - Intronic
1047467900 8:125136498-125136520 AGAGACTAGGTGCCTGCATGTGG + Intronic
1047649202 8:126901316-126901338 AGAGATAGGGTCTCACCATGTGG - Intergenic
1047734730 8:127755286-127755308 AGAGTCAGGGTCTCACCATGTGG + Intergenic
1048240944 8:132741175-132741197 AGAGACAGGGTTTCACCATGTGG - Intronic
1049189270 8:141277925-141277947 AGAGATAAGGTCTCACCATGTGG + Intronic
1049590676 8:143460058-143460080 AGAGACAGGGTCACACCATGGGG - Intronic
1050225787 9:3453522-3453544 AGAGACAGGGTTTCACCATGTGG - Intronic
1050427427 9:5525859-5525881 AGAGACGAGGTTTCACCATGCGG - Intronic
1050550326 9:6743691-6743713 AGAGACAGGGTTTCGTCATGTGG + Intronic
1051805412 9:20987320-20987342 AGAGACAGGGTTTCACCATGTGG - Intronic
1051871057 9:21738151-21738173 AGAGACAGGGTCTCCCCATGTGG + Intergenic
1053789429 9:41676153-41676175 AGAGACAGGGTCTCACTATGCGG - Intergenic
1054177767 9:61887839-61887861 AGAGACAGGGTCTCACTATGCGG - Intergenic
1054659764 9:67692986-67693008 AGAGACAGGGTCTCACTATGCGG + Intergenic
1054761229 9:69006074-69006096 AGAGACAGGGTCTCACTATGTGG + Intronic
1054793317 9:69276076-69276098 AGAGACAAGGTTTCACCATGTGG + Intergenic
1055058428 9:72044884-72044906 AGAGACAAGGTTTCACCATTTGG + Intergenic
1055115529 9:72601318-72601340 AGAGACAGGGTCTCACTATGTGG - Intronic
1055602032 9:77929643-77929665 AGAGACAGGGTTTCACCATGTGG - Intronic
1056346962 9:85706488-85706510 TGAGACAGAGTCCCACCATGTGG - Intronic
1056587209 9:87936630-87936652 AGAGACAGGGTTTCATCATGTGG + Intergenic
1056609667 9:88116313-88116335 AGAGACAGGGTTTCATCATGTGG - Intergenic
1057525367 9:95795036-95795058 AGAGATGAGGTCCGTTCATGTGG + Intergenic
1057948425 9:99350309-99350331 AGAGAGAAGGTCAAATTATGAGG - Intergenic
1058559582 9:106211898-106211920 AGAGACAGGGTTTCACCATGTGG + Intergenic
1059137473 9:111820936-111820958 AGAGACAGGGTTTCACCATGTGG - Intergenic
1059355145 9:113693058-113693080 AGAGACAAGGTCACAGGAGGTGG - Intergenic
1060122169 9:121003103-121003125 AGAGACAGGGTTTCACCATGTGG - Intronic
1060184470 9:121555672-121555694 TGAGACAGGGTCTCATTATGTGG + Intergenic
1060588001 9:124798646-124798668 AGAGACACGGTTTCATCATGTGG - Intronic
1060599100 9:124866216-124866238 AGAGACAGGGTTTCACCATGTGG - Intronic
1060746068 9:126131717-126131739 TGAGACAAGGTGCCAGCCTGCGG + Intergenic
1060808044 9:126590523-126590545 AGAGACAAGGTCTCACTATATGG - Intergenic
1060973163 9:127750338-127750360 AGAGACGAGGTTTCACCATGTGG + Intronic
1061228060 9:129292436-129292458 AGAGACAGGGTTTCATTATGTGG + Intergenic
1061476241 9:130868704-130868726 AGAGACACGGTTTCACCATGTGG + Intronic
1062264771 9:135681933-135681955 AGAGACAGGGTGGCATCCTGGGG - Intergenic
1185509879 X:655990-656012 AGAGACAGGGTTTCACCATGTGG - Intronic
1185520207 X:732925-732947 AGAGACACGGTCTCACCAGGTGG - Intergenic
1185635359 X:1548050-1548072 AGAGACAGGGTTTCACCATGTGG - Intergenic
1185661326 X:1731137-1731159 AGAGACAGGGTTTCACCATGTGG - Intergenic
1185673932 X:1833369-1833391 AGAGACAGGGTTTCACCATGTGG + Intergenic
1185915052 X:4025827-4025849 AGAGACAAGGTCTCATTCTGTGG + Intergenic
1186124517 X:6398627-6398649 AGAGACAGGGTTTCACCATGTGG - Intergenic
1186359329 X:8823151-8823173 AGAGACAGGGTTTCACCATGTGG + Intergenic
1187463466 X:19508051-19508073 AGAGACAGGGTTTCACCATGTGG + Intronic
1187869497 X:23752667-23752689 AGAGACGAGGTCTCATTATGTGG - Intronic
1188665229 X:32811146-32811168 AGAGACCAGGTCTCACTATGTGG - Intronic
1188722711 X:33543300-33543322 AGAGCCTAGCTCCCATCAGGTGG + Intergenic
1189987416 X:46566272-46566294 AGAGACAAGATTTCACCATGTGG - Intergenic
1190939390 X:55026032-55026054 AGAGATGAGGTTCCATCATGAGG + Intronic
1191756128 X:64594421-64594443 CCAGAAAAGGTCCCATCATGTGG + Intergenic
1191833206 X:65437136-65437158 AGAGACAGGGTTTCACCATGTGG + Intronic
1193087831 X:77463283-77463305 AGAGACAGGATCTCATCATGTGG + Intergenic
1194776877 X:97976198-97976220 AGAGACAGGGTTTCACCATGTGG + Intergenic
1195712478 X:107784957-107784979 TGAGACAAGGTCTCATTCTGTGG - Intronic
1195956970 X:110341875-110341897 AGAGACAAGGTTTCACCATGTGG - Intronic
1196690023 X:118549328-118549350 AGAGACGGGGTCTCACCATGTGG + Intronic
1197300385 X:124772827-124772849 AGATATAAGGTCCCATCTAGTGG - Intronic
1198395668 X:136216578-136216600 AGAGACAAGGTCTCACTCTGTGG - Intronic
1198553717 X:137770739-137770761 AGAGACAAGGTTTCACCATGTGG - Intergenic
1199735996 X:150687204-150687226 AGAGAAATGTTCCCATCATTTGG - Intergenic
1200466699 Y:3528647-3528669 AGAGACCAGGTCCCCTCAGCTGG + Intergenic
1200770479 Y:7120309-7120331 AGAGACAAGGTTTCACCATATGG - Intergenic
1200841299 Y:7784247-7784269 AGAGACAGGGTTTCACCATGTGG - Intergenic