ID: 1166972371

View in Genome Browser
Species Human (GRCh38)
Location 19:46577838-46577860
Sequence ATGGTGACTCAGAGCTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166972366_1166972371 5 Left 1166972366 19:46577810-46577832 CCTTCTCTCTCCATAGGGTCTCT 0: 1
1: 0
2: 4
3: 24
4: 361
Right 1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG 0: 1
1: 1
2: 2
3: 34
4: 226
1166972368_1166972371 -5 Left 1166972368 19:46577820-46577842 CCATAGGGTCTCTCCACCATGGT No data
Right 1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG 0: 1
1: 1
2: 2
3: 34
4: 226
1166972361_1166972371 23 Left 1166972361 19:46577792-46577814 CCAAAGGCTCCTTGGCTCCCTTC 0: 1
1: 0
2: 1
3: 34
4: 273
Right 1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG 0: 1
1: 1
2: 2
3: 34
4: 226
1166972365_1166972371 6 Left 1166972365 19:46577809-46577831 CCCTTCTCTCTCCATAGGGTCTC 0: 1
1: 0
2: 2
3: 33
4: 366
Right 1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG 0: 1
1: 1
2: 2
3: 34
4: 226
1166972362_1166972371 14 Left 1166972362 19:46577801-46577823 CCTTGGCTCCCTTCTCTCTCCAT 0: 1
1: 0
2: 12
3: 121
4: 1014
Right 1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG 0: 1
1: 1
2: 2
3: 34
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166972371 Original CRISPR ATGGTGACTCAGAGCTCCCA AGG Intronic
900409970 1:2508036-2508058 CAGGCGCCTCAGAGCTCCCAGGG + Intergenic
900570215 1:3354591-3354613 AAGGTGGTTCTGAGCTCCCATGG - Intronic
901163346 1:7197502-7197524 GTGGGGGCTCAGAGCTCCCTGGG + Intronic
901246211 1:7733232-7733254 ATGGTGACTTAGACCTGCTAGGG + Intronic
901435610 1:9245663-9245685 TTGTGAACTCAGAGCTCCCATGG + Intronic
901885374 1:12218991-12219013 ATGGTGATTCTGAGCTCCAGAGG - Intergenic
902238089 1:15070497-15070519 AGGGTGCCACAGAGCTCCCCAGG - Intronic
902323382 1:15683749-15683771 AGGGTGTCTCTGAGGTCCCAGGG + Intergenic
902664781 1:17929934-17929956 ATGGGGGCTCAGCGCTGCCAGGG - Intergenic
903295050 1:22338466-22338488 AGGGTGCCTCAGAGCTCACAGGG + Intergenic
903845354 1:26276700-26276722 ATTGTGACCCAGAGGGCCCAGGG + Exonic
905093911 1:35452387-35452409 ATGTTGGCACAGAGCTCCCTTGG - Intronic
905486107 1:38298057-38298079 CTGGTGACTCATATCTCCCTGGG + Intergenic
906208713 1:44000575-44000597 GTGGCGACTCAGAGCTGCCTGGG - Intronic
906286379 1:44590455-44590477 ATGCTTCCTCAGAGCTCTCATGG + Intronic
906302876 1:44696335-44696357 AGGATGACTGAGAGCTTCCAAGG - Intronic
909210636 1:72818039-72818061 ATGTTCACTCAGAGCTCCTGGGG + Intergenic
911108973 1:94163290-94163312 ATGCTGATTCAGAGCACACACGG + Intronic
913127134 1:115802647-115802669 ATGTTGGCTCAGGGCTCCCAAGG + Intergenic
917213471 1:172654735-172654757 ATTGTAACTCAGAGCTCCAGAGG - Intergenic
917935314 1:179860808-179860830 ATGGAGACTCAGGGTTGCCAGGG + Intronic
919000550 1:191826462-191826484 ATGCTGATTCAGAGCTTACATGG + Intergenic
922110304 1:222549177-222549199 ATGGTGACTTGTTGCTCCCATGG + Intergenic
922370335 1:224904151-224904173 ATGGTGACCCAGAGCACACTTGG - Intronic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
923062071 1:230484713-230484735 TTTCTGACTCAGAACTCCCATGG - Intergenic
923198950 1:231693683-231693705 ATGCTGGCTCAGTGGTCCCAGGG - Intronic
1067583241 10:47458717-47458739 ATGGAGACTGAGAAGTCCCACGG - Intergenic
1069982415 10:72261440-72261462 ATGGGACCCCAGAGCTCCCAGGG + Intergenic
1070653707 10:78256280-78256302 ATGCTGACTCATAGCTCACAAGG - Intergenic
1071049951 10:81435179-81435201 ATGGTGAATCAGAGGCCACAAGG + Intergenic
1071273849 10:84034758-84034780 AAGGTGGCCCAGTGCTCCCAGGG + Intergenic
1071334326 10:84589001-84589023 ATGGTGGCTCTGAGCATCCAGGG + Intergenic
1071887418 10:89966270-89966292 TTTCTGACACAGAGCTCCCAAGG + Intergenic
1074632351 10:115272672-115272694 ATGCTGACTCAGAGCTTATATGG + Intronic
1075554931 10:123423514-123423536 ATGTTGTCTCTGAGCTACCACGG + Intergenic
1075948860 10:126460407-126460429 CTGGGCACTCTGAGCTCCCAAGG - Intronic
1076154557 10:128193637-128193659 ATGATGACTCTCAGCTACCAGGG - Intergenic
1076441875 10:130485774-130485796 ATGCTGTTTCAGAGCTCCCATGG - Intergenic
1076698280 10:132257431-132257453 AGGGTGCCTGAGAGCTCCCAGGG + Intronic
1077350794 11:2092324-2092346 ATGGTTACTGAGAGCTGCCAGGG + Intergenic
1077366790 11:2164485-2164507 ACAGTGGCTCAGAGCTCCCAGGG + Intronic
1077917364 11:6620076-6620098 ATGGTAACTCAAAGCCCACAAGG + Intergenic
1078964851 11:16327025-16327047 GTGGTGTCTCAGAGATCCAAAGG + Intronic
1079029879 11:16978730-16978752 ATGGTGACTCCGTCCTTCCAGGG - Intronic
1080258299 11:30318242-30318264 ATGGTGTCTCAGAGCTCCCAGGG - Intergenic
1081739884 11:45431354-45431376 GTGGTGCCTCAGAGCTCCTTAGG + Intergenic
1084567608 11:69940292-69940314 CTGGGGACCCAGAGCACCCAAGG + Intergenic
1087109658 11:94450255-94450277 ATGGTGAATCATTGCTCCTAGGG - Intronic
1089402185 11:118170731-118170753 TTGGTGACACCGATCTCCCAGGG + Intronic
1089598825 11:119600488-119600510 ATGGTGCCCCAGATCTCTCAGGG - Intergenic
1089842041 11:121426903-121426925 AGGGCGACTCAGAGATCACAGGG - Intergenic
1090436284 11:126689362-126689384 ATGGGGACTCTGGGCTCCCAGGG - Intronic
1092093817 12:5825338-5825360 ATGGTGATTCAGAGCATACATGG - Intronic
1093508205 12:19894283-19894305 ATGATGAGTCAGATCTTCCATGG + Intergenic
1097312852 12:58140056-58140078 ATTGCTACTCTGAGCTCCCACGG - Intergenic
1097437636 12:59570874-59570896 ATGCTGAATCAGAGCACACACGG + Intergenic
1098293751 12:68983396-68983418 TTGGTCACTCAGTGCTCCTAGGG - Intergenic
1098411485 12:70188976-70188998 ATGATGACTCAGAACTCCAAAGG - Intergenic
1099597185 12:84681935-84681957 ATGGAAACTCAGAAGTCCCATGG - Intergenic
1100302022 12:93316357-93316379 GTGCTGACTGAGAGCTCCCAGGG + Intergenic
1101928187 12:108990804-108990826 ATGCAGCCTCAGAACTCCCACGG + Intronic
1103414317 12:120733696-120733718 ATGGGAACTCAGAGCTACCAGGG - Intronic
1103549833 12:121728853-121728875 ATGGGGACCCAGAGCTCATAGGG - Intronic
1105242672 13:18621633-18621655 ATGGGGTCTCAGAGCTCCTGAGG + Intergenic
1105553558 13:21422867-21422889 ATGGTGACTGAGTAGTCCCAGGG - Intronic
1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG + Intronic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1112436504 13:99394510-99394532 TTCGTTACTCACAGCTCCCAAGG - Intergenic
1112987252 13:105466389-105466411 ATGGCAGCACAGAGCTCCCAGGG + Intronic
1113727660 13:112617209-112617231 ATCCTGACCCAGTGCTCCCAAGG - Intergenic
1114635298 14:24183782-24183804 AGGATGACTCAGAGATCTCAGGG - Exonic
1114713820 14:24804363-24804385 ATGGTGACTCAGTTATCCCAGGG - Intergenic
1116336827 14:43666955-43666977 ATGGTGATTCTTAGCTCCCTGGG - Intergenic
1117491358 14:56250996-56251018 ATGTGGCCTCAGAGCTCCCCAGG - Intronic
1118890720 14:69906309-69906331 ATAGTGGCTCAGGGCTCCAAAGG - Intronic
1118922857 14:70165948-70165970 TTGGAGAAGCAGAGCTCCCAGGG - Intronic
1118950567 14:70433189-70433211 ATGCTGACTCAGAGCATACACGG + Intergenic
1119776180 14:77250246-77250268 AGGGTGTCTCTGAGCTCCCCTGG - Intronic
1119880466 14:78095586-78095608 ATGGTGCCTCAGATCTCCCTAGG - Intergenic
1120337776 14:83180036-83180058 TTGGTCACTCAGAGCTCCTGGGG + Intergenic
1120594498 14:86417045-86417067 ATGCTGATTCAGAGCACACATGG + Intergenic
1120920313 14:89749071-89749093 CTGGTGACTCAGGGCTCCAAAGG + Intergenic
1121275646 14:92665982-92666004 GGGGTCACTCACAGCTCCCAGGG - Intronic
1122257003 14:100485722-100485744 AGGGTGAGACAGAGCCCCCAAGG + Intronic
1123157251 14:106240017-106240039 ATGGTGAGTAAAAGCTCACACGG - Intergenic
1125351123 15:38768575-38768597 AAGGAGACTCAGAGCTACCATGG - Intergenic
1125390138 15:39183861-39183883 ATGGGGACAAATAGCTCCCAAGG - Intergenic
1125988790 15:44084353-44084375 ATGGTGATTCAGGCATCCCATGG - Intronic
1126063265 15:44804445-44804467 ATGCTGATTCAGAAATCCCAGGG + Intergenic
1129880130 15:79000992-79001014 ATGGTGAGAGAGAGCTCCCAGGG - Intronic
1130201274 15:81829308-81829330 ATGGTGACTCAGAGTTCCAAGGG + Intergenic
1130834517 15:87636125-87636147 ATGGAGGCTCAGAGCTCCAAAGG + Intergenic
1133700560 16:8304569-8304591 ATGATGACTCAAAGTTACCAAGG + Intergenic
1135545434 16:23362779-23362801 ATGGGGACACAGTGTTCCCAAGG - Intronic
1136115700 16:28092997-28093019 AGCCTGACTCAGAGCCCCCAGGG - Intergenic
1136234245 16:28904585-28904607 ATGGGGACTCCCAGCCCCCATGG + Exonic
1137486921 16:48899254-48899276 ATGGTGACTCATTGCTCTGAAGG + Intergenic
1137984163 16:53093863-53093885 CTGGTGGGTCAGAGCTCTCAAGG - Intronic
1143984063 17:10895933-10895955 AAGGTGACACAGAGCTGCCAGGG + Intergenic
1144199656 17:12928853-12928875 ATGTTTTCTCAGTGCTCCCATGG + Intronic
1144541858 17:16151375-16151397 AAGGTGACTGAGCGCTTCCAAGG + Intronic
1146490674 17:33279339-33279361 ATGGTGAATCAGGGCATCCAGGG + Intronic
1146555306 17:33817979-33818001 ACGTTGGCTCAAAGCTCCCAAGG + Intronic
1147879096 17:43642489-43642511 ATGGAGACCCAGAGGTCCCAGGG + Intronic
1150274090 17:63884767-63884789 ATGGTGACTCAGAGGACTCTAGG + Intergenic
1150276246 17:63899572-63899594 ATGGTGACTCAGAGGACTCTAGG + Intergenic
1150278403 17:63914301-63914323 ATGGTGACTCAGAGGACTCTAGG + Intronic
1150279499 17:63920932-63920954 ATGGTGACTCAGAGGACTCTAGG + Intergenic
1152648785 17:81482433-81482455 AGGGGGACTGAGGGCTCCCAGGG - Intergenic
1154446270 18:14438244-14438266 ATGGGGTCTCAGAGCTCCTGAGG - Intergenic
1154454800 18:14510892-14510914 CTCCTGAGTCAGAGCTCCCAGGG - Intronic
1161034705 19:2078120-2078142 TTGGTGAGTCAGAGCTGGCAGGG - Exonic
1161202366 19:3022739-3022761 ATGCGGATACAGAGCTCCCATGG + Intronic
1164738717 19:30561061-30561083 ATGGTAACTCACTGCTCACAAGG + Intronic
1165473406 19:36016083-36016105 AGGGTGACTCAGGGCTCCTCGGG + Exonic
1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG + Intronic
1168278041 19:55287769-55287791 ATAGTGACTCAGACCTCCTAAGG - Intronic
925024277 2:595345-595367 AGGGGGTCTCAGAGCTCCCGCGG + Intergenic
925907378 2:8547529-8547551 ATGATGGCTCAGAGGTCCCCAGG + Intergenic
926151909 2:10429940-10429962 ATGGAGGCTGAGAGGTCCCAAGG + Intergenic
927858615 2:26543337-26543359 ATGGTGAGTCTGAGACCCCAAGG - Intronic
928824925 2:35408572-35408594 ATGGTGATTCTGAACTCCTAAGG - Intergenic
930004194 2:46882916-46882938 TTGCTGACTCCCAGCTCCCATGG + Intergenic
930599352 2:53425151-53425173 ATGGTGAGTGAGAGTCCCCAGGG - Intergenic
932011742 2:67984860-67984882 ATGTTAGCTCAGAGCTCCCAAGG - Intergenic
932409145 2:71534960-71534982 ATGGGGACTCTGGGCTCCCCCGG - Intronic
933666503 2:84969632-84969654 TGGGTCACTCAGAACTCCCAAGG - Intergenic
935543463 2:104376426-104376448 ATAGTAACCCAGAGCCCCCAAGG + Intergenic
937253819 2:120540980-120541002 ATAGTGGCTCGGAGCCCCCAGGG - Intergenic
937518084 2:122678589-122678611 ATGGTGTCCCAGGGCTCCAAAGG + Intergenic
937568735 2:123331284-123331306 ATGGTGTCTCCTAGCTCCCTTGG - Intergenic
938260150 2:129889758-129889780 AAGGTGATTCAGAGATCACAGGG - Intergenic
939788491 2:146544732-146544754 ATGCTGACTCAGAGCATACATGG + Intergenic
942283947 2:174395455-174395477 ATGGTGTCTCTGAGATCCCTAGG - Intronic
943159996 2:184235393-184235415 ATGGTGCCTCAGGGATTCCATGG - Intergenic
945994482 2:216424525-216424547 CCAATGACTCAGAGCTCCCAGGG - Intronic
946584147 2:221165202-221165224 ATAGTAACAAAGAGCTCCCAAGG + Intergenic
946809483 2:223508372-223508394 TTGGTGACTCAAAGATACCATGG + Intergenic
947475794 2:230446706-230446728 TGGGTGACTCAGAGCTCAGAGGG - Intronic
949077982 2:242073508-242073530 CTGGTGACTCAGTTCTCCGACGG - Intergenic
1168965950 20:1898038-1898060 GGGGTGACTCAGAGGTCTCAAGG - Intronic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1172391885 20:34571043-34571065 ATGATGACCCACAGCTTCCAGGG - Intronic
1173341670 20:42157839-42157861 ATGGTGGCTCAGAACTCCATAGG - Intronic
1173538841 20:43836450-43836472 ATGGAGGCTCAGACCACCCAAGG + Intergenic
1174582081 20:51579283-51579305 ACAGTGACTCAGACCTCCCCAGG - Intergenic
1175061151 20:56244424-56244446 AAGTTGAATCTGAGCTCCCACGG + Intergenic
1175210958 20:57354387-57354409 CTGTTGACTCAGAATTCCCATGG + Intronic
1176449711 21:6851602-6851624 ATGGGGTCTCAGAGCTCCTGAGG + Intergenic
1176827883 21:13716626-13716648 ATGGGGTCTCAGAGCTCCTGAGG + Intergenic
1177327724 21:19613871-19613893 ATGGTGACTGCAATCTCCCAAGG + Intergenic
1177962029 21:27679640-27679662 GTGCTGCCTCAGGGCTCCCATGG - Intergenic
1180074484 21:45455758-45455780 AGGGTGGCTCAGGGCTGCCAGGG - Exonic
1181099649 22:20530794-20530816 CAGGTGACTCAGAGCTCCAATGG + Intronic
1181426333 22:22843485-22843507 ATGATCATTCAGTGCTCCCATGG - Intronic
1182427552 22:30282929-30282951 CAGGTGACCAAGAGCTCCCAAGG + Intergenic
1182811878 22:33123751-33123773 GTGGTGAATCCGAGCTTCCAAGG - Intergenic
1184716614 22:46286207-46286229 AGCCTGACTCACAGCTCCCAAGG + Intronic
949445801 3:4132451-4132473 ATGGTGATTCAGAGCATACATGG - Intronic
951245081 3:20331444-20331466 ATAGTTTCTAAGAGCTCCCAGGG - Intergenic
951384712 3:22028905-22028927 ATGCTGATTCAGAGCACACATGG - Intronic
951797825 3:26560773-26560795 ATGGTGCCTCAGAGGTTCCTCGG + Intergenic
954132675 3:48568386-48568408 ATAGTGACCCAGTGCTCTCATGG - Intronic
954559546 3:51544969-51544991 ATGGTGACACTGAGCTCAGATGG - Intronic
954710272 3:52502010-52502032 ATGGGGTCTCAGCGCCCCCAGGG - Exonic
954786786 3:53099216-53099238 CTGGTGCCACAGAGATCCCAGGG + Intronic
955236640 3:57145178-57145200 AGTGTGATTCAGAGCTCCCAGGG + Intronic
956046865 3:65205102-65205124 ATGGTGGCTCAGGGCTCCAGAGG - Intergenic
956748176 3:72325904-72325926 ATGGTGGCTCAGGTCTCCAAAGG + Intergenic
956972075 3:74537860-74537882 ATGGTAACCCAGAGCTTGCAAGG + Intergenic
958934494 3:100241997-100242019 ATGCTGATTCAGAGCACACATGG - Intergenic
960533339 3:118789559-118789581 TGGGTGTCTCAGAGTTCCCAAGG - Intergenic
961242033 3:125419458-125419480 TTGGTCACTCAGTGCTCCTAGGG - Intergenic
961658685 3:128457063-128457085 ATGGAGACACAGAGATGCCAAGG - Intergenic
962188418 3:133284594-133284616 ATGATGAATCCCAGCTCCCATGG + Intronic
962391326 3:134975213-134975235 ATGGGGACTCAGAGAGCTCAGGG + Intronic
962961656 3:140316625-140316647 ATTGTGTCTCAGATCTCTCAGGG + Intronic
962964728 3:140342891-140342913 ATGGTGTCTCAGGGCCCCAAAGG + Intronic
963922423 3:150918713-150918735 CTGGTGGTTCAGTGCTCCCAAGG + Intronic
964451595 3:156817634-156817656 ATGGTGACTCAAAAGCCCCAAGG + Intergenic
964704936 3:159607991-159608013 TTGGTCCCTCACAGCTCCCAGGG - Intronic
964793906 3:160477688-160477710 ATCATGACACAGAGGTCCCAAGG + Intronic
968869102 4:3232357-3232379 ATGGGGACACAGAATTCCCATGG - Intronic
969163586 4:5283349-5283371 ATGGTGTCTCATAATTCCCATGG - Intronic
970897860 4:21124310-21124332 ATGGTGTCTCAGAGATCCCTGGG + Intronic
971097566 4:23425046-23425068 ATGGTGTCTCAGGGCTCCAAAGG - Intergenic
971268418 4:25114693-25114715 CTGGTGACTCAGACCTTCCTGGG - Intergenic
972877003 4:43374897-43374919 ATGGAGCCTGAGAGGTCCCACGG + Intergenic
973702140 4:53547819-53547841 TTGGTACCTCAGAGCTCCCATGG + Intronic
974298671 4:60036710-60036732 ATGGAGACTGAGAAGTCCCATGG - Intergenic
975261262 4:72302413-72302435 ATAGTGACTTAGAGCTCAAAAGG + Intronic
977652369 4:99485236-99485258 ATGCTGAGTGAGAGTTCCCAGGG - Intergenic
979487433 4:121284710-121284732 ATGGTGACTCAAAACTTCCATGG - Intergenic
981985256 4:150846551-150846573 ATGGAGACTCAGAACTCAGAAGG + Intronic
983527004 4:168769710-168769732 GTGGTGACTCAGAAATCTCAAGG + Intronic
983784199 4:171711834-171711856 AGGGGGCCCCAGAGCTCCCATGG + Intergenic
985790695 5:1925579-1925601 ATGGCAACTCAGAGCCCCCAAGG - Intergenic
992082023 5:73242940-73242962 ATGGTGATTCAGTGCTGCCTGGG - Intergenic
992186313 5:74248138-74248160 ATGTTGGCTGAGGGCTCCCAAGG + Intergenic
992314418 5:75537353-75537375 ACGGTGAGTGAGAGCCCCCAGGG - Intronic
992826101 5:80551545-80551567 GTGGTGACTCAGATCTTCCTAGG + Intergenic
995347393 5:111136129-111136151 TAGGTGACTCAGAACTCCCTCGG - Intergenic
995654599 5:114411398-114411420 ATGGAGACTGAGAAGTCCCAAGG + Intronic
997466610 5:134092353-134092375 ACAGTGACTCAGAGCCCCCTTGG - Intergenic
997626929 5:135337380-135337402 ATGCTGACTGGGAGGTCCCAAGG + Intronic
999443199 5:151618988-151619010 ATGTGAACTTAGAGCTCCCAGGG - Intergenic
1003613729 6:7636267-7636289 ATTGTGACTCAGACCTCCAAAGG + Intergenic
1004899472 6:20181196-20181218 ATGGTGACTCCCCGCTCCCCAGG + Intronic
1007786801 6:44284955-44284977 ATGGTGTCCCAGAGCTCCTAAGG + Intronic
1011000272 6:82580897-82580919 CTGGTTACTGAGACCTCCCAGGG - Intergenic
1016175876 6:141077358-141077380 ATTGTGTCTCAGAGCTCCTTAGG + Intergenic
1016412900 6:143802283-143802305 ATGGGGGATCAGAGCTCCAATGG - Intronic
1018698920 6:166412062-166412084 CTGGTGACACGGAGCTCTCAAGG + Exonic
1019141725 6:169951362-169951384 AGGTTGACTTGGAGCTCCCAAGG - Intergenic
1019334810 7:478090-478112 ATGGTGACACAGGGCTCCTGAGG + Intergenic
1019747315 7:2708219-2708241 GTGGGGACTCACAGGTCCCAGGG + Intronic
1026966948 7:74446159-74446181 CTGCTGATCCAGAGCTCCCAGGG + Intergenic
1027669577 7:81078841-81078863 TTTGTGACTTAGAGCTCCAAGGG + Intergenic
1028340441 7:89712823-89712845 ATGGTAGCTCAGGGCTCTCACGG - Intergenic
1031748541 7:125538886-125538908 AGGGTGACTGAGACCTCCTAGGG - Intergenic
1031838362 7:126706287-126706309 ATGGTGACTGACAAATCCCAAGG + Intronic
1032821656 7:135529573-135529595 ATGTTGACTCATAGTTCACATGG - Intergenic
1034254784 7:149718932-149718954 CTGGTGACCCAAAGCTTCCAAGG + Intronic
1035556746 8:572786-572808 ATGTGGAACCAGAGCTCCCAGGG - Intergenic
1037915265 8:22769143-22769165 AAGCTGGCTGAGAGCTCCCAGGG - Intronic
1038597550 8:28902639-28902661 ATAGTGCCTCAGGGCTCCAAAGG + Intronic
1039846976 8:41332418-41332440 GTGGAGACACAGAGATCCCAAGG - Intergenic
1040087755 8:43364028-43364050 TTCCTGAGTCAGAGCTCCCAGGG + Intergenic
1042035367 8:64526978-64527000 ATGGAGAGTCAGAGCTGCCTGGG - Intergenic
1044234513 8:89814980-89815002 ATGATGACTCAGAGTTCCTCAGG - Intergenic
1044533191 8:93331123-93331145 AGGGTGACTCAGAAATCCAACGG + Intergenic
1044636427 8:94329429-94329451 GTGGTCAATCAGATCTCCCAGGG + Intergenic
1045398609 8:101787266-101787288 CTAGAGACTCAAAGCTCCCAAGG + Intronic
1047314769 8:123722783-123722805 ATGATGACTCAGGGCTGGCAGGG + Intronic
1047860294 8:128958400-128958422 ATGTTGACTCAGAGGTTCCATGG - Intergenic
1047905718 8:129471162-129471184 ATGGAGACTGAGAAGTCCCAAGG + Intergenic
1050068896 9:1789971-1789993 AATGAGACTCAGACCTCCCAAGG + Intergenic
1051182193 9:14423259-14423281 CTGGTCACTCCGTGCTCCCATGG - Intergenic
1053282105 9:36827079-36827101 ATGGTGTCCCACAGCTCACAAGG + Intergenic
1056310002 9:85331071-85331093 ATGGTAACTCAGAGCTCCAGAGG + Intergenic
1056456825 9:86768366-86768388 ATGGGGACTCAGACCTCACCAGG + Intergenic
1056544338 9:87601352-87601374 CTTGTGACTCTGAGCTCCCAAGG + Intronic
1058670504 9:107357155-107357177 ATGATGACTCAGAGTTCCACTGG - Intergenic
1059277957 9:113111243-113111265 TTGATGACTCAGAGCTCCTGCGG - Intergenic
1059278294 9:113113308-113113330 TTGATGACTCAGAGCTCCTGCGG + Intergenic
1059998695 9:119938946-119938968 ATAGTGCCTCATAGCTCCCCTGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061446330 9:130640301-130640323 ATGATGTCCCAGAGCCCCCAAGG + Intergenic
1062051871 9:134451654-134451676 ATGGTGAATCAGAGGCTCCAAGG + Intergenic
1062189929 9:135242731-135242753 ATGGAAACTCAGAGAGCCCAGGG - Intergenic
1062564409 9:137157546-137157568 ATGGGGACTGAAAGCTTCCAGGG + Intronic
1203519473 Un_GL000213v1:32915-32937 ATGGGGTCTCAGAGCTCCTGAGG - Intergenic
1188611702 X:32107430-32107452 ATGGAGACTGACAACTCCCAAGG + Intronic
1189247282 X:39572880-39572902 ATGATAGCTCAGGGCTCCCAAGG - Intergenic
1189355828 X:40309284-40309306 ATGGTAGCTCAGAGCTCCAAAGG - Intergenic
1189860872 X:45270605-45270627 ATGATGGCTCAGAGATCCAAAGG - Intergenic
1192486623 X:71533126-71533148 ATGGTCAATTAGAGTTCCCAGGG + Exonic
1193315425 X:80059302-80059324 TTGGTCACTCAGTGCTCCTACGG + Intergenic
1193833140 X:86311487-86311509 ATGGTGATTCAGAGCATACATGG - Intronic
1197420066 X:126227715-126227737 ATGCTGACTCAGAGCATACAGGG - Intergenic
1198733384 X:139758998-139759020 AGCATGAGTCAGAGCTCCCAAGG + Intronic
1199686267 X:150268305-150268327 ATGGTGACTCAGAGGACCCAGGG + Intergenic
1199693149 X:150324491-150324513 TAGGTGAGTCATAGCTCCCATGG - Intergenic