ID: 1166974759

View in Genome Browser
Species Human (GRCh38)
Location 19:46599452-46599474
Sequence CTCCCTTGAGGCACTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166974754_1166974759 13 Left 1166974754 19:46599416-46599438 CCCCACTTTGTCTGTGGCTATTC 0: 1
1: 0
2: 0
3: 26
4: 223
Right 1166974759 19:46599452-46599474 CTCCCTTGAGGCACTCCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 102
1166974750_1166974759 20 Left 1166974750 19:46599409-46599431 CCCACCTCCCCACTTTGTCTGTG 0: 1
1: 3
2: 5
3: 72
4: 383
Right 1166974759 19:46599452-46599474 CTCCCTTGAGGCACTCCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 102
1166974756_1166974759 11 Left 1166974756 19:46599418-46599440 CCACTTTGTCTGTGGCTATTCTC 0: 1
1: 2
2: 7
3: 43
4: 317
Right 1166974759 19:46599452-46599474 CTCCCTTGAGGCACTCCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 102
1166974753_1166974759 16 Left 1166974753 19:46599413-46599435 CCTCCCCACTTTGTCTGTGGCTA 0: 1
1: 1
2: 5
3: 29
4: 219
Right 1166974759 19:46599452-46599474 CTCCCTTGAGGCACTCCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 102
1166974755_1166974759 12 Left 1166974755 19:46599417-46599439 CCCACTTTGTCTGTGGCTATTCT 0: 1
1: 1
2: 1
3: 31
4: 274
Right 1166974759 19:46599452-46599474 CTCCCTTGAGGCACTCCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 102
1166974751_1166974759 19 Left 1166974751 19:46599410-46599432 CCACCTCCCCACTTTGTCTGTGG 0: 2
1: 1
2: 12
3: 54
4: 428
Right 1166974759 19:46599452-46599474 CTCCCTTGAGGCACTCCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166974759 Original CRISPR CTCCCTTGAGGCACTCCTGA TGG Intronic
911441008 1:97925523-97925545 ATCCCTTGAGGGACCTCTGAAGG - Intergenic
919913143 1:202124046-202124068 CTCCCTTCAGGCACTCCTTCAGG - Intronic
921245244 1:213231949-213231971 GTCCCTGGAGGCTCTGCTGATGG - Intronic
921578204 1:216863089-216863111 CTCCCTCCAGGCAATTCTGATGG - Intronic
922816148 1:228450801-228450823 CTCATTTGAGGCACTCCCGTTGG - Intergenic
924903086 1:248423103-248423125 CTCCTTTGGGGCACCCCTGGGGG - Intergenic
924924769 1:248668699-248668721 CTCCTTTGGGGCACCCCTGGGGG + Intergenic
1070848630 10:79544537-79544559 CTCCCTTGATGCACTTTGGAGGG - Intergenic
1074156889 10:110807470-110807492 CTCACTGGGGGCACCCCTGAGGG + Intronic
1075189878 10:120297291-120297313 CTCCCTCTAGGCACTTCTAATGG - Intergenic
1076763537 10:132617492-132617514 CTCCTGTGAGCCACACCTGAAGG + Intronic
1077655964 11:4018921-4018943 TTGCCTTGTTGCACTCCTGAAGG + Intronic
1078194143 11:9120973-9120995 CTTACATGAGGCACTGCTGAGGG + Intronic
1078610226 11:12813333-12813355 CTCACTTGAGGCACTCTTAAAGG - Intronic
1080656627 11:34263576-34263598 CTTCCCTGAGGCTCTCCTGCAGG + Intronic
1085665934 11:78416513-78416535 CTCCCTTGATGCACTGCAGCTGG + Intronic
1087193256 11:95278824-95278846 ATCCCTTGAGGAACTCTAGATGG + Intergenic
1088503390 11:110506727-110506749 TTCTCTTGGGGCACCCCTGAAGG - Intergenic
1089626021 11:119751570-119751592 GTCCCTGGAGGCGCTGCTGATGG + Intergenic
1090269043 11:125373024-125373046 CTCCCTTGAGACTATCCTAAAGG + Intronic
1092504660 12:9084173-9084195 CTCCCTTCAGTAATTCCTGAAGG - Intronic
1092956773 12:13558552-13558574 CTCCCTTGGGCAACTCCTGATGG + Exonic
1095724145 12:45433747-45433769 CTGCCTTGCAGCATTCCTGAGGG + Intronic
1102397530 12:112599940-112599962 ATCCCGTGATGCACTCCAGAAGG - Intronic
1102893816 12:116582486-116582508 CTCCCTGGAGGCAAGGCTGAAGG - Intergenic
1116899835 14:50350885-50350907 CTCCCCAGAGGCACTCCTTCTGG + Intronic
1124551182 15:30682673-30682695 CAACGCTGAGGCACTCCTGAGGG + Intronic
1125334035 15:38610083-38610105 TTCCCTTGAGGGAGTCTTGAAGG + Intergenic
1128361503 15:66964910-66964932 GTCCCTTGGGACACTTCTGAAGG + Intergenic
1136289229 16:29261625-29261647 GTCCCCTCAGGCACTCCTGGTGG - Intergenic
1137414526 16:48262541-48262563 CTCCCTGGTGGGACTCCAGAAGG + Intronic
1139571624 16:67816512-67816534 CTCCCTGGAGTCACTCCCGCAGG - Intronic
1140564686 16:76027397-76027419 CTCCTTTGTGGGACTCATGAAGG - Intergenic
1141631438 16:85290178-85290200 CCCCTTTGTGGCACTCCTGAGGG + Intergenic
1142596089 17:1030771-1030793 CTCCCTTGTTGCTCTCTTGATGG + Intronic
1143918559 17:10312949-10312971 CTCCCTGGAGGTGCTCCTTAGGG - Intronic
1148214910 17:45829274-45829296 CTCCCTGGTGGCCCTCCTGGTGG + Exonic
1149271461 17:54983066-54983088 CTCCCTTGTGGGGCTCCTGTGGG + Intronic
1151718959 17:75844976-75844998 CTCCCTTCAGACACCCTTGAAGG + Intergenic
1156176299 18:34551116-34551138 CTCCATTCATGCTCTCCTGATGG + Intronic
1158321258 18:56267214-56267236 CTGCCTTTACGGACTCCTGATGG + Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1159889742 18:73942445-73942467 CTGCCTTTAGGCAATTCTGATGG - Intergenic
1161096779 19:2396651-2396673 CACCCTGGAGGCACTGGTGAGGG + Exonic
1162305638 19:9871719-9871741 CACCCGTGAGGCCCTCCTAATGG - Intronic
1163640699 19:18460507-18460529 CTCCCTTCAGCAACTCCTGCTGG + Intronic
1165140132 19:33694485-33694507 CTGTCTTGGGGCACTCCTGCAGG + Intronic
1166974759 19:46599452-46599474 CTCCCTTGAGGCACTCCTGATGG + Intronic
927098121 2:19763632-19763654 CTTCCCTGAGCCCCTCCTGATGG - Intergenic
932717114 2:74109149-74109171 CTCCCTTCAGGCTCTGCAGATGG - Intergenic
932779928 2:74553652-74553674 CTCCCTTAGGGCGCTCCTGGCGG + Intronic
934066995 2:88350021-88350043 CTCTCTTGAGTGACACCTGATGG + Intergenic
936900314 2:117474504-117474526 CTCCCGTGAGGCAGGCCTGGTGG - Intergenic
944486590 2:200213222-200213244 GTCCCTTGGGCAACTCCTGAGGG - Intergenic
946167478 2:217873766-217873788 CTCTCCTGAGGCACTTCTGTAGG - Intronic
946321921 2:218959554-218959576 CTCCCGAGTTGCACTCCTGATGG - Intergenic
947535324 2:230936657-230936679 CCCCTTTGAGCCACTCCTGCAGG - Intronic
947813880 2:233023145-233023167 CTGGCTTGAGACACTCCTGGAGG + Intergenic
1169025978 20:2371932-2371954 CTCCCTAGATGCAATCCTGGAGG - Intergenic
1170323640 20:15130827-15130849 ATCTCCTGAGGTACTCCTGATGG + Intronic
1173329600 20:42063387-42063409 GTCCCTTGAGGCCCTGCTGGGGG + Intergenic
1173924676 20:46771810-46771832 CTGCCTGGTGGCTCTCCTGAGGG - Intergenic
1175906609 20:62382973-62382995 GCCCCTGGAGGCTCTCCTGATGG + Intergenic
1177431517 21:20997418-20997440 CTCCCTCGGTGCACTCCTGGCGG + Intergenic
1178722491 21:35022358-35022380 CACCCTTCAGGCACTCCTGCGGG - Intronic
1182351787 22:29703781-29703803 CTGCCCTGAGGAGCTCCTGAGGG - Intergenic
1183747873 22:39702656-39702678 CTCCCTTGAGCCATTTCTAAAGG + Intergenic
1184327453 22:43799989-43800011 CTCCCTTCAGGCACTTGTGATGG - Intronic
955055502 3:55451778-55451800 CTCCCTCAAGGAACTCCTAAAGG + Intergenic
962197946 3:133379832-133379854 CTCCCTTCAGGCACTCCCCCGGG + Exonic
968913943 4:3489101-3489123 CTCCCTGGATGCAGCCCTGAGGG + Intronic
973944690 4:55944658-55944680 ATTTCTTGAGGCACCCCTGAGGG - Intergenic
975753708 4:77551283-77551305 TTCCTTTGAGGCTCTCTTGAAGG + Intronic
979248086 4:118532645-118532667 CTATCTAGAGGCACTCCAGATGG - Intergenic
979632540 4:122920237-122920259 CTACCTTGAAGAACTCCTGCTGG - Intronic
980806413 4:137820348-137820370 CTCACTACAGGCACTCCTGTAGG + Intergenic
983739403 4:171109698-171109720 CTCCCTTCAGGGTCTCCAGAAGG + Intergenic
986314346 5:6576318-6576340 CTCCCTGGAGACACTCCTGTGGG - Intergenic
990506350 5:56449208-56449230 CTCCCTTGAAGCTCACCGGAAGG + Intergenic
991156329 5:63440685-63440707 CTCCCTTGACCCCCTCCTGTTGG + Intergenic
992408909 5:76485754-76485776 CTCCCTAGAGCCACACCTGGGGG - Intronic
994388388 5:99159996-99160018 CTCCTTTGAGCTCCTCCTGAAGG + Intergenic
997639959 5:135442623-135442645 CACCCTGCAGGGACTCCTGAGGG - Intergenic
1001117940 5:168955324-168955346 CTCCCTAGAGGCTCTCCCAAGGG + Intronic
1004674314 6:17826337-17826359 CTAACATGATGCACTCCTGATGG + Intronic
1006454887 6:34125976-34125998 CTCCCCTGAGCACCTCCTGAGGG + Intronic
1012865781 6:104616377-104616399 CTTCCTTGAGGATCTACTGAAGG + Intergenic
1018156326 6:160988656-160988678 CTTCCTTGTGGTATTCCTGAGGG - Intergenic
1022931030 7:35114814-35114836 GTCCCTTCATGCACTCCTTATGG + Intergenic
1026336658 7:69399470-69399492 CTCTCATGAGACACTCCAGAAGG - Intergenic
1033182180 7:139191077-139191099 ACCCCTTGAGACAGTCCTGAAGG - Exonic
1038944312 8:32340407-32340429 CTCCCATGAGACAGTCATGAAGG - Intronic
1039085420 8:33775178-33775200 ATCCCTGGACTCACTCCTGATGG - Intergenic
1040560505 8:48519705-48519727 CTCCCTTGTGGGACCCATGAGGG + Intergenic
1040605843 8:48930344-48930366 CCCACTTGAGACACTCCTGTGGG + Intergenic
1044267944 8:90205132-90205154 CTTCCTTTAGGCATTCTTGAAGG - Intergenic
1045168767 8:99639883-99639905 CTTCCTTGAGCCACCACTGAGGG + Intronic
1048011938 8:130464756-130464778 CTCCCATAACGCACTGCTGATGG - Intergenic
1049849111 8:144821293-144821315 CTGCCGTGAGACACACCTGACGG + Intergenic
1051159939 9:14196222-14196244 CTCCCATGAGGCACTCAGGGAGG + Intronic
1056821719 9:89846926-89846948 AACCCTTGAGGGACTCCTGATGG - Intergenic
1057050008 9:91916430-91916452 CTCCCTGCAGGGAGTCCTGAGGG + Intronic
1057189925 9:93081328-93081350 CTTCCTTCAGGCCCTCCTGCTGG + Intronic
1060278908 9:122202855-122202877 CTGCCTTGAGCCTCTCCTCAGGG - Exonic
1060356962 9:122917957-122917979 CTCTCTTGAGGAACACCTGCAGG - Exonic
1062567773 9:137170894-137170916 CTCCCTGCAGGCCCTCCTGAGGG - Intronic
1186883235 X:13887279-13887301 GTCCCTACAGGCCCTCCTGAAGG - Intronic
1187972451 X:24672602-24672624 CTTCCATGATGCACTCCTGATGG + Intronic
1188802673 X:34551069-34551091 CTCTCTTGATGCACACATGAGGG + Intergenic
1195662980 X:107399447-107399469 CTCCCTTTAGAGACTCCAGAAGG + Intergenic
1195704247 X:107727229-107727251 CTCCCTTGATGCATTTGTGAAGG + Intronic
1199557676 X:149126747-149126769 TTCCCTTGAGGAACTGCTGCTGG - Intergenic
1201536243 Y:15051859-15051881 CTCTTTTAAGGCAGTCCTGATGG + Intergenic