ID: 1166976752

View in Genome Browser
Species Human (GRCh38)
Location 19:46609427-46609449
Sequence CTCCCCAAGGGGATCTGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166976752_1166976761 3 Left 1166976752 19:46609427-46609449 CCTCCCCAGATCCCCTTGGGGAG 0: 1
1: 1
2: 1
3: 28
4: 262
Right 1166976761 19:46609453-46609475 CTGCCCTCCTCCAGCCCGGATGG 0: 1
1: 0
2: 2
3: 38
4: 392
1166976752_1166976768 19 Left 1166976752 19:46609427-46609449 CCTCCCCAGATCCCCTTGGGGAG 0: 1
1: 1
2: 1
3: 28
4: 262
Right 1166976768 19:46609469-46609491 CGGATGGCTCTCCTCCATTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1166976752_1166976759 -1 Left 1166976752 19:46609427-46609449 CCTCCCCAGATCCCCTTGGGGAG 0: 1
1: 1
2: 1
3: 28
4: 262
Right 1166976759 19:46609449-46609471 GCCTCTGCCCTCCTCCAGCCCGG 0: 1
1: 3
2: 51
3: 194
4: 1086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166976752 Original CRISPR CTCCCCAAGGGGATCTGGGG AGG (reversed) Exonic
901376887 1:8845903-8845925 CTCCCCGGGGGGACCTGGGTTGG - Intergenic
901815519 1:11791323-11791345 CACCCTGAGGGGATGTGGGGTGG + Exonic
901946212 1:12706179-12706201 ATCCCCAAGTGGATGTGTGGTGG - Intergenic
902048535 1:13543690-13543712 CTTCCCGGGGGGAGCTGGGGAGG - Intergenic
904014173 1:27407510-27407532 CTCACCAAAGGGATCCTGGGAGG + Exonic
905061075 1:35139614-35139636 ATCCCCAAGCGGATGTGTGGTGG - Intergenic
905712873 1:40121744-40121766 CTCTCCAAGTGGCTGTGGGGTGG - Intergenic
906702878 1:47872538-47872560 CTCCCCATGTGCATGTGGGGAGG + Intronic
907304978 1:53508385-53508407 TGCCCCAAGGGCCTCTGGGGCGG + Intronic
911850373 1:102811160-102811182 CTCCCCAAGGAGTTCTGGGCTGG + Intergenic
912816099 1:112829888-112829910 ATCCCCAAGCGGATGTGTGGTGG + Intergenic
915323496 1:155069029-155069051 CTCCTCCAGGGGATCTTGGGAGG - Exonic
915586240 1:156845400-156845422 CCTTCCAAGGGGATCTGGGGAGG + Exonic
916174568 1:162026857-162026879 CTCTCCAAGGAGCTCTGGGCTGG + Intergenic
916766524 1:167866103-167866125 ATCCCCAAGCGGATGTGTGGTGG + Intronic
917090605 1:171349908-171349930 CTCTCCAAGGAGTTCTGGGATGG + Intergenic
918251718 1:182708893-182708915 CTCCCCAAGCAGCTCTGGGCAGG + Intergenic
919802505 1:201362081-201362103 CACCCCCAGGGGGTTTGGGGAGG - Intronic
920071820 1:203307635-203307657 CTCTCCAAAGGCACCTGGGGAGG - Exonic
920497282 1:206464130-206464152 CTCCCCAAGGAGATGAGGAGCGG + Exonic
920692726 1:208159154-208159176 CTTCCCTAGAGGCTCTGGGGAGG + Intronic
921049862 1:211503637-211503659 CTCCTCACTGGGCTCTGGGGCGG - Intergenic
924196490 1:241612898-241612920 CTCCCTGAGGAGATCTGGGTTGG - Intronic
924328686 1:242921227-242921249 CTCCCTAAGGAGTTCTGGGCTGG + Intergenic
924729137 1:246696181-246696203 GTCCCCAAGTGGAGCTGGAGAGG - Intergenic
1064215562 10:13397376-13397398 CACCCCAAAGGGATCCAGGGTGG + Intergenic
1065874239 10:29983312-29983334 CTCCCCCAGGAGTTCTGGGCTGG + Intergenic
1068987486 10:63120709-63120731 CTCCCCAAGGACTTCTGGGCTGG + Intergenic
1070972489 10:80578996-80579018 CCCACCATGGGGAGCTGGGGAGG + Intronic
1072164815 10:92802845-92802867 CTCCCCTAGGTGACCTGGGTGGG + Intergenic
1072509047 10:96100067-96100089 CTTCAGAAGGGGACCTGGGGAGG + Intergenic
1072764000 10:98081332-98081354 CTCCCAAAGGGGATTTGAGGGGG + Intergenic
1073064470 10:100750027-100750049 ATCCCCAAAGGGGTCTGGAGAGG + Intronic
1073095824 10:100979094-100979116 CTCCCCAGGGAGACCTGGGAGGG + Exonic
1075154922 10:119967338-119967360 CTCTCCAAGGAGTTCTGGGCTGG + Intergenic
1076889068 10:133275210-133275232 CTCGCCAAGTGAAACTGGGGAGG + Intronic
1076983868 11:221594-221616 CACCTAAAGGGGATCTGGAGTGG + Intronic
1077146801 11:1050126-1050148 CTTCCCCCAGGGATCTGGGGAGG - Intergenic
1077406237 11:2383689-2383711 CTCCCCAAGAGCATCAAGGGAGG + Intronic
1078206394 11:9233749-9233771 CTCCCCAAGAGCCTCTGAGGGGG + Intronic
1079133770 11:17764610-17764632 CTCCCCAAGGTGCTCCGTGGAGG - Intronic
1080532188 11:33187969-33187991 TTCCCCATGGGGTTCTGGGATGG - Intergenic
1081540508 11:44031309-44031331 CTCCCCCAGGGTATCTGCTGAGG + Intergenic
1081611435 11:44565535-44565557 CTTCCCAAAGGGCTCGGGGGCGG + Intronic
1081957692 11:47107856-47107878 CTGCCCCAAGGGAACTGGGGGGG - Intronic
1082090749 11:48087768-48087790 CTACCCAAGGGGTTCACGGGAGG + Intronic
1083254974 11:61490206-61490228 CTGAGCAAGGGGCTCTGGGGTGG + Intronic
1083255087 11:61490765-61490787 CTGAGCAAGGGGCTCTGGGGTGG - Intronic
1083617659 11:64034664-64034686 CTCCCCAAGGGGATCTGGGAGGG + Intronic
1084506691 11:69572830-69572852 CTCAAAAAGGGGATCTGGGCAGG + Intergenic
1084658328 11:70532302-70532324 CTCCACAAGGGGGTCTGCTGGGG + Intronic
1084938115 11:72597973-72597995 CTTCCCAAGGAGAACTAGGGTGG + Intronic
1085309160 11:75506072-75506094 CCTCCCAAGGGGCTCTGGGAAGG - Intronic
1085998819 11:81954437-81954459 ATCCCCAAGCGGATATGTGGTGG + Intergenic
1087305689 11:96487045-96487067 CTCCCCAAGGGAAGCTGTGAGGG + Intronic
1088847994 11:113683647-113683669 CACTCCAGGGGGATCTGTGGAGG - Intergenic
1090281046 11:125456144-125456166 CTCCCCAGCGGGCTCTGGTGTGG - Intronic
1091597377 12:1887111-1887133 CCCAGCCAGGGGATCTGGGGTGG - Intronic
1092247338 12:6871126-6871148 CTCCCCTTGGGGAGGTGGGGAGG - Exonic
1092247347 12:6871135-6871157 CTCCCCAAGGGGAGGGGTGGTGG + Exonic
1093925308 12:24903154-24903176 CTCCCCAAGGGATGCTGGAGGGG - Intronic
1096098770 12:48956607-48956629 CTCCCCAGGCGGAGCGGGGGCGG - Intronic
1096242219 12:49965551-49965573 CTTCCTAAGGAGCTCTGGGGAGG - Exonic
1097246169 12:57608963-57608985 CTCCCTTAGGGGAGGTGGGGAGG + Intronic
1099673962 12:85732957-85732979 CTCCCTAAGGAGTTCTGGGCTGG + Intergenic
1101023341 12:100574799-100574821 TTCCCAAAGGGAATCTGAGGTGG - Intronic
1101414671 12:104498726-104498748 CTGCTCAAGCGGATGTGGGGTGG + Intronic
1103304867 12:119956016-119956038 CTCCTCAAGGAGTTCTGGGCTGG - Intergenic
1103714378 12:122935418-122935440 CTCACCAGGGAGATCTGGGGAGG + Exonic
1104118617 12:125775082-125775104 CTACCCTAGGGGATCTAGGAAGG + Intergenic
1104846528 12:131849993-131850015 CTCCACAGGGGGCTCTGGGCGGG - Exonic
1105569547 13:21588628-21588650 ATCCCCAAGCGGATGTGTGGTGG + Intronic
1107658955 13:42619578-42619600 CTCCTAAAGGGGAACTGTGGAGG - Intergenic
1114492709 14:23113431-23113453 CTCCCCAAGGGGAGAGGGTGTGG - Intergenic
1117955122 14:61116874-61116896 ATCCCCAAGTGGATGTGTGGTGG - Intergenic
1118806375 14:69240787-69240809 CGCGCCAAGGGTAACTGGGGAGG - Intronic
1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG + Intronic
1119941877 14:78649780-78649802 CTGCCACAGGTGATCTGGGGAGG + Intronic
1121009483 14:90511634-90511656 CTGCCTAAGGTGATCTGGGCTGG - Intergenic
1121049344 14:90810221-90810243 ATTCCCAATGGGGTCTGGGGCGG - Intronic
1122061562 14:99139712-99139734 CTCCCCATGGTGCTCTGGGCTGG - Intergenic
1127260019 15:57320607-57320629 CTCCCCAGGCTGCTCTGGGGGGG - Intergenic
1127902914 15:63354470-63354492 CTCCCCAAGGGGAGATTTGGGGG - Intronic
1128311473 15:66633807-66633829 GCCAACAAGGGGATCTGGGGAGG - Intronic
1129674253 15:77623698-77623720 GTCCCCATGGGGGTCTGAGGAGG - Intronic
1132414880 15:101612877-101612899 CTGCCCAAGGCCATGTGGGGAGG - Intergenic
1132553597 16:563557-563579 CTCCCCAGGGCGGTCTGGGGTGG - Exonic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132824409 16:1896254-1896276 CCCCGCAAGGGGATCCAGGGAGG + Intergenic
1133846020 16:9454540-9454562 CTCCCCAAGGAATTCTGGGCTGG - Intergenic
1134132185 16:11657377-11657399 GTCCCCAAGGAGGTCTTGGGAGG + Intergenic
1134241794 16:12512142-12512164 GTCCCCCAGGGGATGTAGGGAGG + Intronic
1134277082 16:12786229-12786251 CTCACCCAGTGGATCTGGGCTGG - Intronic
1136096607 16:27961566-27961588 TTCCTCAAGGGGTTGTGGGGAGG + Intronic
1137247248 16:46715912-46715934 CTTTCCAAGAGGATCTGTGGGGG - Intronic
1138029040 16:53544989-53545011 CTCCCCAAGGTGAGAAGGGGCGG - Intergenic
1138062529 16:53906894-53906916 CTCCCACAGGGTACCTGGGGTGG - Intronic
1139432704 16:66919624-66919646 CCCCCCAGGGGGACCTGTGGTGG + Intergenic
1140376326 16:74448113-74448135 CTCCCCAAAGCCATCTGGTGAGG - Intergenic
1140406239 16:74713483-74713505 CTCCCCAAGGGAGGCTGAGGAGG - Exonic
1140566506 16:76049046-76049068 CTGGCAAAGGGGTTCTGGGGAGG + Intergenic
1141593025 16:85081266-85081288 CTCTCCAAGGGGAGGCGGGGAGG - Intronic
1141720865 16:85754552-85754574 ATCCCCAAGGGGAGACGGGGGGG - Intergenic
1142261353 16:89043931-89043953 CTCCCCAAGGGTCTCTGGTGTGG + Intergenic
1142409952 16:89910937-89910959 CTCCTCACAGGGACCTGGGGAGG + Intronic
1142807229 17:2377683-2377705 CTCCACAAGGAGATCCGAGGGGG + Intronic
1143267549 17:5651452-5651474 CTCCCCAAAGAGTTCTGGGCTGG - Intergenic
1143547925 17:7610671-7610693 TTCTCCAAGGGTATCTGTGGTGG + Intronic
1143556957 17:7667992-7668014 GTTCCCAAGGGGAACAGGGGTGG - Intronic
1143749837 17:9020705-9020727 CTGCCTCAGGGGATCTGGGGAGG + Intergenic
1146831090 17:36070146-36070168 CTCCCCAAGGAGAGATGGGATGG + Intronic
1147363118 17:39943841-39943863 CTCCCCAGAGGGACCTCGGGAGG + Intronic
1149797096 17:59530613-59530635 CTCCGAAAGCAGATCTGGGGAGG + Intergenic
1150296359 17:64010076-64010098 CTCCCCAAAGAGTTCTGGGCTGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151263438 17:72935418-72935440 CTGCTCAAGGGAATATGGGGAGG + Intronic
1151429007 17:74050088-74050110 CAGGCCAAGGGGAGCTGGGGAGG - Intergenic
1155308138 18:24498878-24498900 CTCGCCAAGGGGCTCTGGGTGGG + Intergenic
1156933369 18:42672534-42672556 CTTCCCCAGGAGCTCTGGGGGGG - Intergenic
1156946124 18:42834070-42834092 CTCCCCAAGCTGATGTGGAGTGG + Intronic
1157100024 18:44720910-44720932 CTCCCCAAGGGGTTGGGGTGGGG - Intronic
1162133480 19:8541847-8541869 CCCCCCAAGGGGATGGAGGGAGG - Intronic
1162327514 19:10007678-10007700 CTCACCACGGGGAGCTGGGGCGG + Intronic
1162751671 19:12833539-12833561 CTCACCAAGGGGGTCTCTGGGGG + Intronic
1162883773 19:13680977-13680999 CTCCCCAAGGAGTTCTGAGCTGG + Intergenic
1163180000 19:15592569-15592591 CTCCCCCAGGAGTTCTGGGCTGG + Intergenic
1163184647 19:15629084-15629106 CTGCCCAAGGTGATCTGGGTGGG + Intronic
1164004051 19:21133043-21133065 CTTGCCAAGGAGATCTGGGAAGG + Intergenic
1164747653 19:30627996-30628018 CTCCCCACGGGAAGCAGGGGTGG - Intronic
1164848866 19:31462262-31462284 TTCCCCATGGGACTCTGGGGAGG - Intergenic
1165302087 19:34976696-34976718 CTCCCCAAGGAGTTCTGGGCTGG - Intergenic
1166507531 19:43380392-43380414 CTGGCCAAGGGGATGTGGGTAGG + Intergenic
1166633608 19:44429745-44429767 CTCCCACAGGGGCTCTGGGGTGG + Exonic
1166694426 19:44844692-44844714 CTGCCCAGGGGGAGCTGGTGAGG - Intergenic
1166976752 19:46609427-46609449 CTCCCCAAGGGGATCTGGGGAGG - Exonic
1168403669 19:56099950-56099972 CTCCCCAAGAGGCTCAGGAGGGG + Intronic
924988267 2:289430-289452 CTCTCGCAGGGGGTCTGGGGAGG - Intergenic
925751082 2:7090975-7090997 TTCCCCAAGGGCAGGTGGGGCGG + Intergenic
926138267 2:10352703-10352725 CCCCCCAGGGAGAGCTGGGGAGG + Intronic
928212020 2:29330389-29330411 CTCCCCAAATGGAGGTGGGGAGG - Intronic
928477542 2:31645641-31645663 CTCCCCAAAGTGTTCTAGGGAGG + Intergenic
928938787 2:36707002-36707024 CTCCTCAAGGGGCTCTTCGGTGG + Intronic
929581886 2:43086559-43086581 CTCCCCAAGAGGAAGTGGGTGGG - Intergenic
932379498 2:71269478-71269500 CTTCCCAAGGAGATGTAGGGAGG - Intergenic
932841305 2:75085306-75085328 CTCCCCAAGGAGTTCTGGGCTGG - Intronic
935017960 2:99202094-99202116 CTCCACATGGGGACATGGGGTGG + Intronic
935721417 2:105982617-105982639 ATCCCCAAGTGGATGTGTGGTGG - Intergenic
937250259 2:120519372-120519394 CTCCCCAGTGGGAGCTGGAGTGG + Intergenic
937267541 2:120626008-120626030 CTGACCAAGGGGTTCTGGGATGG - Intergenic
938261803 2:129902137-129902159 CTGGCCAAGGAGACCTGGGGTGG - Intergenic
939039933 2:137176592-137176614 ATGGCCAAGGGGATCTGGGCAGG - Intronic
946467382 2:219924187-219924209 CTCACCAAGGGGATGTGGAAAGG + Intergenic
947308861 2:228778306-228778328 CTCCCCAAGGAGTTCTGGGCTGG - Intergenic
947575435 2:231270017-231270039 CCACCCAGGGGGATCTGGGTGGG + Intronic
947627309 2:231628079-231628101 CACAGAAAGGGGATCTGGGGAGG + Intergenic
947876627 2:233471834-233471856 CACCACAAGGGGACCTGGGCCGG - Exonic
948771187 2:240251947-240251969 CTCCCCCAGGGGTGCTGGGCTGG + Intergenic
948872556 2:240810885-240810907 CTCCCCAGGGTGATGTGGGTCGG + Intronic
949031280 2:241798665-241798687 GGCCCCCAGGGGATCTGGAGAGG - Intronic
1170612883 20:17928873-17928895 CTCGCCAAGGGCCCCTGGGGAGG - Intergenic
1171531723 20:25857637-25857659 CACCCAAAGCGGATCCGGGGCGG + Intronic
1171573688 20:26277545-26277567 CTCCCAAAGCGGATCCGCGGCGG - Intergenic
1172805000 20:37605387-37605409 CTCCAGAGGGGGCTCTGGGGAGG + Intergenic
1173867503 20:46321996-46322018 CACCTCATGGGGATTTGGGGAGG + Intergenic
1174898641 20:54475885-54475907 CACCCGAAGTGGCTCTGGGGAGG - Exonic
1175146110 20:56897692-56897714 GTCCCCAACGGGCTCTGAGGAGG + Intergenic
1175308857 20:57997533-57997555 TTACCCAAGGGGAGCAGGGGAGG + Intergenic
1175964569 20:62654107-62654129 CTCCCCCTGGGGCTCTGAGGAGG + Intronic
1175975196 20:62707542-62707564 CTCTCCCAGGGGTTCTGGGGAGG + Intergenic
1176240795 20:64074989-64075011 CTCCCCTGGGGGAGATGGGGTGG + Intronic
1176241224 20:64076808-64076830 CTCCCCTGGGGGAGATGGGGTGG - Intronic
1178303372 21:31470872-31470894 CTTGCCAAGGGGAGCTGGGCTGG + Intronic
1179892847 21:44345628-44345650 GTTCCCAAGGGCATCTGGGAGGG - Intergenic
1180047902 21:45318257-45318279 CTCCCCAAGCGCATGTCGGGGGG - Intergenic
1180781196 22:18520808-18520830 CTCCCCAACAGGATATGGTGGGG + Intergenic
1181114891 22:20625819-20625841 CTTCCCAAGGGGGTATGAGGAGG - Intergenic
1181791320 22:25269190-25269212 CTCCCCAAGGAGTTCTGGGCTGG + Intergenic
1181827062 22:25525659-25525681 CTCCCCAAGGAGTTATGGGCTGG + Intergenic
1181831511 22:25564465-25564487 CAACCCAAGGGGTTATGGGGAGG - Intergenic
1182958791 22:34452824-34452846 CTCCCCAGAGGGCTCTGGGCTGG - Intergenic
1183003835 22:34883791-34883813 CTCCCCAAGGGACCCTGGAGGGG - Intergenic
1183421770 22:37715885-37715907 CTCCCACAGGGGACCTGGTGAGG - Exonic
1184331094 22:43828372-43828394 CAACCCAGGTGGATCTGGGGAGG + Intronic
1184444191 22:44537734-44537756 CTCCTCCAGGGGATGTGGGGAGG + Intergenic
1185219628 22:49622849-49622871 CCTCCCAAGGGGCGCTGGGGAGG + Intronic
1185275507 22:49948839-49948861 CTCCCCCAGGGGACCTGGGCAGG - Intergenic
949991579 3:9583601-9583623 CTCACCAAGGAGTTCTGGGCTGG + Intergenic
950597530 3:13997515-13997537 CTACCCAAGGGAAGCTGGGAGGG - Intronic
950841187 3:15969838-15969860 TTCCTGAAGGGGATCTGGGTGGG + Intergenic
953407605 3:42667197-42667219 CCTCCCAAGGAGATCTGTGGGGG + Intergenic
954466662 3:50659123-50659145 CTCCACAACTGGGTCTGGGGAGG + Intergenic
954604870 3:51901480-51901502 ATCCCCGAGGGGATGTGTGGTGG + Intronic
956635097 3:71356005-71356027 ATTCCCAAGAGGATCTGTGGGGG + Intronic
956721319 3:72120516-72120538 CTATCCCAGGGGATGTGGGGAGG + Intergenic
957379916 3:79413885-79413907 CTCCCCAAGGGCATCAGGGAAGG + Intronic
962212408 3:133490481-133490503 CTGACCAAGGTGATCTGTGGTGG + Intergenic
962411625 3:135146106-135146128 CACCCCAAGGGGCTTTGGGTTGG + Intronic
964309076 3:155373046-155373068 CTCTCCAAGGTGATCTTGGCTGG - Intergenic
968046964 3:195630002-195630024 CTGCCCAAGGGTCTCTTGGGGGG - Intergenic
968307689 3:197660042-197660064 CTGCCCAAGGGTCTCTTGGGGGG + Intergenic
971193472 4:24449219-24449241 CTCCCCAAGGAGTTCTGGGCTGG - Intergenic
971329901 4:25673793-25673815 TTCCCCAAGACAATCTGGGGTGG - Intronic
973641378 4:52906129-52906151 CTCTCCAAGGGCAGGTGGGGTGG + Intronic
973886829 4:55330715-55330737 CTCCCCAAGGAGTTCTGGGCTGG - Intergenic
974025352 4:56728837-56728859 CTCCCCATTAGGACCTGGGGTGG + Intergenic
974991430 4:69095231-69095253 CTCCTCAAGGAGTTCTGGGTTGG + Intronic
975021588 4:69497358-69497380 CTCCTCAAGGAAATCTGGGCTGG - Intronic
975911844 4:79276600-79276622 ATCCCCAAGTGGATGTGTGGTGG + Intronic
978579168 4:110215616-110215638 CTCCCCGAGGAGTTCTGGGCTGG + Intergenic
980771066 4:137373975-137373997 CTTCCCAAGGAGTTCTGGGCTGG + Intergenic
980950842 4:139374811-139374833 CCCCCAAAGGAGATCTGGGTTGG - Intronic
983977436 4:173952618-173952640 CTCACCAAGGGGATCTAGACGGG + Intergenic
984702842 4:182829117-182829139 CTCTCCATGGGGCTCTGGGATGG + Intergenic
984893026 4:184510334-184510356 CTCCCCAAGGAGTTCTTGGCTGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
986208026 5:5644501-5644523 CTCCTCCTGGGGATTTGGGGAGG - Intergenic
986459385 5:7954558-7954580 CTGCCCTAGGAGTTCTGGGGAGG + Intergenic
987653651 5:20776902-20776924 CTCCACAAGGTGATGTGGTGAGG + Intergenic
988741926 5:34084591-34084613 CTCCACAAGGTGATGTGGTGAGG - Intronic
989150641 5:38296081-38296103 CTCAACATGGGGATTTGGGGTGG + Intronic
991564055 5:67986090-67986112 TTGCCCAAGGGGGTCTGGGGAGG + Intergenic
997407529 5:133663734-133663756 CTCCCCCATGGGCTCTGGGCTGG + Intergenic
999696338 5:154190980-154191002 CACCCCTGGGGGATCGGGGGCGG + Exonic
1000328398 5:160188851-160188873 CACCCCAAGGGGATGGGGGAGGG - Intronic
1002469181 5:179424763-179424785 CCACCCAAGGAGAGCTGGGGTGG + Intergenic
1003946450 6:11080461-11080483 CTTCCCCAGAGGATGTGGGGTGG + Intergenic
1003954364 6:11148136-11148158 CACCCCGAGGGGTTCTAGGGTGG + Intergenic
1004003754 6:11620635-11620657 ATCCCCAAAGGGATCTGGATCGG - Intergenic
1004122397 6:12837000-12837022 CTCCTCAAGGAGTTCTGGGCTGG - Intronic
1005323979 6:24681744-24681766 ATCTCCAAAGGGATCTAGGGAGG - Intronic
1005462012 6:26078228-26078250 ATCCCCAAGCGGATGTGTGGTGG + Intergenic
1006682254 6:35805567-35805589 CTCCCCAGCGGGGTTTGGGGAGG - Exonic
1007664197 6:43505029-43505051 CTCCCCATTGGGTTGTGGGGTGG - Exonic
1007718717 6:43872601-43872623 CCCCCCAAGAGGAGCTGGGGAGG + Intergenic
1011522613 6:88225898-88225920 CTAGCCAAGGGAATGTGGGGGGG + Intergenic
1014961762 6:127695256-127695278 GCCCCCCAGGGCATCTGGGGTGG + Intergenic
1016312854 6:142753357-142753379 CTTCCCAGGGGGTTCTGGTGGGG + Exonic
1017441375 6:154467177-154467199 CTCCCGGTGGGTATCTGGGGAGG - Intronic
1017506752 6:155075455-155075477 CTCCCCAGTGGGATCAGGGGAGG - Intronic
1018188859 6:161291380-161291402 CTCCCCAGGGGTCTGTGGGGAGG - Intergenic
1018432088 6:163730502-163730524 CACCCCCAGGCTATCTGGGGGGG - Intergenic
1018973996 6:168550468-168550490 CTCGCCATGGGGTTCTGAGGTGG - Intronic
1019173031 6:170145483-170145505 GTCACCAAGTGGAGCTGGGGAGG + Intergenic
1019509622 7:1411252-1411274 CCCCCCAGGGGGCTGTGGGGAGG - Intergenic
1021024138 7:15643472-15643494 CTCCCATAGGGGAACAGGGGTGG + Intronic
1022063522 7:26826020-26826042 ATCCCCATGGAGATTTGGGGAGG - Intronic
1022652992 7:32294077-32294099 CTCTCAGAGGGGATCTGGGCAGG - Intronic
1022788673 7:33664591-33664613 CTCCACTCGGGGACCTGGGGAGG + Intergenic
1023872856 7:44272154-44272176 CTCCCTCTGGAGATCTGGGGCGG + Intronic
1026290591 7:69002414-69002436 CTCTCCAAGGAGTTCTGGGCTGG + Intergenic
1029125948 7:98295297-98295319 CCTGCCCAGGGGATCTGGGGAGG - Intronic
1029529738 7:101117375-101117397 CTACACAAGGGGGTCTGGGATGG + Intergenic
1032170624 7:129581712-129581734 GTCCCCAAGCGGATATGCGGTGG + Intergenic
1033643411 7:143283927-143283949 CTCCCCAGGGACAGCTGGGGTGG - Intronic
1034469168 7:151246511-151246533 CTGCCCAGGGGGGCCTGGGGTGG + Intronic
1034746756 7:153529869-153529891 CTTCCCAAAGGGGCCTGGGGAGG - Intergenic
1034900622 7:154906015-154906037 CTCCCCCAGGGGATGGGGCGGGG + Intergenic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1035209343 7:157316333-157316355 ATCCCCAGGGGCAACTGGGGAGG - Intergenic
1035265896 7:157690239-157690261 ATCCCCAAGTGGGTCTAGGGTGG - Intronic
1036208835 8:6825689-6825711 CATCCCAAGAGGATCCGGGGTGG - Intronic
1037820441 8:22132442-22132464 CACCCTCAGGGGAGCTGGGGAGG - Intronic
1037855208 8:22366976-22366998 CTCCTCCAGGGGGTGTGGGGTGG + Intergenic
1038229230 8:25685238-25685260 GTCCCCAAGGTGATGTGAGGTGG - Intergenic
1038448104 8:27617925-27617947 CTCTCCAAGGGGAGCAGGGAGGG + Intergenic
1044847921 8:96399794-96399816 CACCTCAAGGGGTTCTTGGGAGG - Intergenic
1045314047 8:101027875-101027897 CTCCTCCAGGTGATCTGGGGTGG + Intergenic
1047431614 8:124798188-124798210 ACCCCCAGGGGGCTCTGGGGTGG + Intergenic
1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG + Intergenic
1053110609 9:35456755-35456777 ATCCCCAAGTGGATGTGTGGTGG - Intergenic
1053127251 9:35592290-35592312 GTCCCAAAGGGAATGTGGGGAGG - Intergenic
1053340644 9:37324777-37324799 CTGGCCAAGGGGAGCTGAGGAGG + Intronic
1054161263 9:61673354-61673376 CACCCCAAGCGGATCCGCGGTGG + Intergenic
1055011197 9:71567388-71567410 ATACCCAAGGGGGTCAGGGGAGG + Intergenic
1056414341 9:86361945-86361967 ATCCCCAAGTGGATATGTGGTGG - Intergenic
1058205420 9:102100054-102100076 CTCCCAAGTGGGATTTGGGGTGG + Intergenic
1059345503 9:113625367-113625389 CTCCCCAAAGGGCTGTTGGGTGG - Intergenic
1059656848 9:116365253-116365275 CTCCCCCAGGCCACCTGGGGAGG + Intronic
1060213772 9:121726142-121726164 CTGCCCCAGGGGCTGTGGGGTGG - Intronic
1060229332 9:121815113-121815135 CTCCCCAAGGGTAGAAGGGGAGG + Intergenic
1060676243 9:125517732-125517754 CTCACGAATGGGCTCTGGGGAGG + Intronic
1062555690 9:137112580-137112602 CTCCCCCAGGGTTTCTGGGAAGG + Intronic
1062672111 9:137717061-137717083 CTCCCCAAGGGTGGCTGGTGGGG - Exonic
1187378426 X:18778519-18778541 TTCTCCCAGGTGATCTGGGGAGG + Intronic
1187822505 X:23303107-23303129 CTTCCCAAGGGGCTATGGAGTGG - Intergenic
1188440814 X:30214268-30214290 CTCCCCAAGGAGTTCTGGGCTGG + Intergenic
1189915909 X:45855786-45855808 CTCCCCTAGAGGAACTGGAGGGG + Intergenic
1190136757 X:47805450-47805472 CTCACCAAAGGGATCCTGGGAGG - Intergenic
1190904254 X:54710484-54710506 CTCCCCAAGGAGTTCTGGGCTGG - Intergenic
1192915396 X:75646189-75646211 ATCCCCAAGCGGATGTGTGGTGG - Intergenic
1193325271 X:80172730-80172752 ATACCCTAGGGCATCTGGGGGGG - Intergenic
1201226069 Y:11820273-11820295 CTCCCTAAGGAGTTCTGGGCTGG + Intergenic