ID: 1166978149

View in Genome Browser
Species Human (GRCh38)
Location 19:46617161-46617183
Sequence CCTGCAGGGGGGTGGGAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166978134_1166978149 22 Left 1166978134 19:46617116-46617138 CCTCTTTGAGGAAACCGCAGCCA No data
Right 1166978149 19:46617161-46617183 CCTGCAGGGGGGTGGGAGCGCGG No data
1166978137_1166978149 2 Left 1166978137 19:46617136-46617158 CCATCTGTTGCGGCCTCAGCCAA No data
Right 1166978149 19:46617161-46617183 CCTGCAGGGGGGTGGGAGCGCGG No data
1166978136_1166978149 8 Left 1166978136 19:46617130-46617152 CCGCAGCCATCTGTTGCGGCCTC No data
Right 1166978149 19:46617161-46617183 CCTGCAGGGGGGTGGGAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166978149 Original CRISPR CCTGCAGGGGGGTGGGAGCG CGG Intergenic