ID: 1166980945

View in Genome Browser
Species Human (GRCh38)
Location 19:46631699-46631721
Sequence CCAGCTCAGAGGTGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166980936_1166980945 10 Left 1166980936 19:46631666-46631688 CCACAGACATGATGCAACCAGGC No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980933_1166980945 19 Left 1166980933 19:46631657-46631679 CCGGGGCTCCCACAGACATGATG No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980934_1166980945 11 Left 1166980934 19:46631665-46631687 CCCACAGACATGATGCAACCAGG No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980938_1166980945 -7 Left 1166980938 19:46631683-46631705 CCAGGCCGGAGCCAAGCCAGCTC No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980929_1166980945 28 Left 1166980929 19:46631648-46631670 CCGTCTCCCCCGGGGCTCCCACA No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980931_1166980945 21 Left 1166980931 19:46631655-46631677 CCCCGGGGCTCCCACAGACATGA No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980927_1166980945 30 Left 1166980927 19:46631646-46631668 CCCCGTCTCCCCCGGGGCTCCCA No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980930_1166980945 22 Left 1166980930 19:46631654-46631676 CCCCCGGGGCTCCCACAGACATG No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980928_1166980945 29 Left 1166980928 19:46631647-46631669 CCCGTCTCCCCCGGGGCTCCCAC No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data
1166980932_1166980945 20 Left 1166980932 19:46631656-46631678 CCCGGGGCTCCCACAGACATGAT No data
Right 1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166980945 Original CRISPR CCAGCTCAGAGGTGGGAAGC AGG Intergenic
No off target data available for this crispr