ID: 1166983874

View in Genome Browser
Species Human (GRCh38)
Location 19:46648657-46648679
Sequence AGCGACTCAGACGGCAGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1569
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 1530}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166983874_1166983879 -6 Left 1166983874 19:46648657-46648679 CCACCGCTGCCGTCTGAGTCGCT 0: 1
1: 0
2: 0
3: 38
4: 1530
Right 1166983879 19:46648674-46648696 GTCGCTGGAGGCAGAGCTGAAGG 0: 1
1: 0
2: 4
3: 16
4: 371
1166983874_1166983880 -2 Left 1166983874 19:46648657-46648679 CCACCGCTGCCGTCTGAGTCGCT 0: 1
1: 0
2: 0
3: 38
4: 1530
Right 1166983880 19:46648678-46648700 CTGGAGGCAGAGCTGAAGGCAGG 0: 1
1: 0
2: 14
3: 81
4: 657
1166983874_1166983881 15 Left 1166983874 19:46648657-46648679 CCACCGCTGCCGTCTGAGTCGCT 0: 1
1: 0
2: 0
3: 38
4: 1530
Right 1166983881 19:46648695-46648717 GGCAGGCGATTCTCCCTCGCTGG 0: 1
1: 0
2: 1
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166983874 Original CRISPR AGCGACTCAGACGGCAGCGG TGG (reversed) Exonic