ID: 1166983913

View in Genome Browser
Species Human (GRCh38)
Location 19:46648796-46648818
Sequence GGGCAGCGACTCCGAGTGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 174}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166983913_1166983923 21 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983923 19:46648840-46648862 CGCTGGGGAGCTGACGGGGACGG 0: 1
1: 0
2: 3
3: 25
4: 312
1166983913_1166983917 5 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983917 19:46648824-46648846 GCCGTAAAGCAGACGACGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 11
1166983913_1166983924 22 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983924 19:46648841-46648863 GCTGGGGAGCTGACGGGGACGGG 0: 1
1: 0
2: 1
3: 41
4: 370
1166983913_1166983927 28 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983927 19:46648847-46648869 GAGCTGACGGGGACGGGCCGGGG 0: 1
1: 0
2: 0
3: 23
4: 189
1166983913_1166983920 15 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983920 19:46648834-46648856 AGACGACGCTGGGGAGCTGACGG 0: 1
1: 0
2: 0
3: 22
4: 132
1166983913_1166983919 6 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983919 19:46648825-46648847 CCGTAAAGCAGACGACGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1166983913_1166983921 16 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983921 19:46648835-46648857 GACGACGCTGGGGAGCTGACGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1166983913_1166983916 4 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983916 19:46648823-46648845 AGCCGTAAAGCAGACGACGCTGG 0: 1
1: 0
2: 0
3: 0
4: 23
1166983913_1166983926 27 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983926 19:46648846-46648868 GGAGCTGACGGGGACGGGCCGGG 0: 1
1: 0
2: 2
3: 25
4: 301
1166983913_1166983925 26 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983925 19:46648845-46648867 GGGAGCTGACGGGGACGGGCCGG 0: 1
1: 0
2: 0
3: 32
4: 428
1166983913_1166983922 17 Left 1166983913 19:46648796-46648818 CCGAGCACTCGGAGTCGCTGCCC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1166983922 19:46648836-46648858 ACGACGCTGGGGAGCTGACGGGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166983913 Original CRISPR GGGCAGCGACTCCGAGTGCT CGG (reversed) Exonic
901045991 1:6396009-6396031 CGGCCGCGGCTCCGAGTGCGAGG + Intergenic
901181246 1:7343220-7343242 GCTCAGCGACTCCGATGGCTTGG + Intronic
901794745 1:11673674-11673696 GGGCAGGGACACCCAGTACTGGG + Exonic
902800811 1:18828893-18828915 AGGCAGCAACCCCGAGGGCTGGG + Intergenic
903809848 1:26029195-26029217 GGGCAGCGTCTCCTGGCGCTGGG - Exonic
904687799 1:32273519-32273541 GGGCTGCTCCTCAGAGTGCTTGG - Intronic
906157592 1:43622946-43622968 GGGAAGCAACTCCGTGTGCCTGG + Exonic
906296057 1:44649878-44649900 GGGCATCGAGTACGAGTCCTAGG - Exonic
910609769 1:89128321-89128343 GGCCGGCTGCTCCGAGTGCTGGG + Intronic
911807974 1:102235090-102235112 GGCCAGCCACTCCGAATGCAGGG + Intergenic
912538774 1:110396617-110396639 GGCCAGCCTCTCCGAGTGCGGGG + Intergenic
912682734 1:111739380-111739402 GGGAAGCGACTCTGAGTCCCGGG - Exonic
915865572 1:159494888-159494910 GGCCAGCTGCTCCGAGTGCAGGG + Intergenic
916057712 1:161079589-161079611 CGGCTGCGGCTCCGAGTGCTGGG - Exonic
917406323 1:174711478-174711500 GGCCAGCCGCTCCGAGTGCGGGG - Intronic
918542719 1:185649207-185649229 GGCCAGCCACTCCGAGTGCGGGG + Intergenic
920371890 1:205484373-205484395 GGGCAGTGACTCTGAGGGCCAGG - Intergenic
921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG + Exonic
922417060 1:225431446-225431468 GGCCAGCCGCTCCGAGTGCGGGG - Intergenic
923380802 1:233415930-233415952 GGGCAGGGACTCCGGGTTATAGG + Intergenic
1063688520 10:8261352-8261374 GTGCAGAATCTCCGAGTGCTGGG + Intergenic
1064391007 10:14942178-14942200 GTGCAGCTCCTCCGAGTCCTGGG + Intronic
1064401370 10:15024187-15024209 GTGCAGCTCCTCCGAGTCCTGGG + Intergenic
1065965859 10:30769699-30769721 GGCCAGCCGCTCCGAGTGCAGGG + Intergenic
1065995484 10:31055903-31055925 GGCCAGCGGCTCCGAGTGAGGGG - Intergenic
1066613621 10:37275604-37275626 GGACAGCTGCTCCGAGTGCAGGG + Intronic
1067569337 10:47360133-47360155 GGGTGGTGACTCTGAGTGCTGGG + Intergenic
1069280857 10:66651743-66651765 GGCCTGCGGCTCCGAGTGCGGGG + Intronic
1069551734 10:69368806-69368828 AGGCAGCACCTCCGAGAGCTGGG - Intronic
1074430678 10:113391586-113391608 GGGCAGTGACTCAAAGTGCAGGG - Intergenic
1077047809 11:554073-554095 GGGCGTCGGCTCCGAGTCCTGGG + Exonic
1077108114 11:850575-850597 GGGCAGCCGCTCTGAGTGCAGGG - Intronic
1077815601 11:5683028-5683050 GGCCGGCCACTCCGAGTGCGGGG - Intronic
1078886643 11:15506945-15506967 GGTCTGTGAGTCCGAGTGCTTGG + Intergenic
1080199073 11:29647625-29647647 GGGCAGCAACACTGAGTGATGGG - Intergenic
1081047708 11:38296547-38296569 GGCCAGCCACTCCCAGTGCAGGG + Intergenic
1081115345 11:39192831-39192853 GGCCAGCAGCTCCGAGTGCGGGG + Intergenic
1081374724 11:42344612-42344634 GGCCGGCCGCTCCGAGTGCTGGG + Intergenic
1084406094 11:68974520-68974542 GGCCAGCTGCTCCGAGTGCGGGG + Intergenic
1085375867 11:76060645-76060667 GGCCGGCCACTCCGAGTGCGGGG - Intronic
1085447262 11:76609309-76609331 GGCCGGCTACTCCGAGTGCCGGG + Intergenic
1087441199 11:98185498-98185520 GGCCAGCCACTCTGAGTGCGGGG + Intergenic
1089543718 11:119206456-119206478 CGGCAGCGGCTCCGGGGGCTCGG + Exonic
1090330929 11:125931763-125931785 TGGCAGCGACTCTGAGCTCTAGG + Intergenic
1092410942 12:8252470-8252492 GGCGAGCCACTCCGAGTGCAGGG + Intergenic
1092732456 12:11547373-11547395 GGCCTGCCGCTCCGAGTGCTGGG - Intergenic
1093972943 12:25391509-25391531 GGCCAGCTACTCGGAGTGCGGGG - Intergenic
1095123079 12:38442033-38442055 GGCCAGCGGCTCTGAGTGCAGGG - Intergenic
1099716250 12:86296682-86296704 GGCCAGCGGCTCCGAGTGCGGGG + Intronic
1102904006 12:116660806-116660828 GGCCGGCGGCTCCGAGTGCGGGG - Intergenic
1104989869 12:132619194-132619216 GGGCTGGGACTCGGGGTGCTGGG + Intronic
1107450076 13:40500370-40500392 GGGCAGCGACTGCAAGGGATAGG - Intergenic
1108856541 13:54799958-54799980 GGCCAGCTGCTCCGAGTGCGGGG + Intergenic
1109008545 13:56909970-56909992 GGGCAGCCACTCCACGTGATAGG + Intergenic
1112226483 13:97545357-97545379 GGCCAGCCACTCCGAGTGCAGGG - Intergenic
1113925317 13:113938692-113938714 AGGGAGCGACTCCCAGTGGTGGG - Intergenic
1117723218 14:58646783-58646805 GGCTAGCGACTCCGAGTACTCGG + Exonic
1118338921 14:64879240-64879262 GGGCCGGGCCTCCGGGTGCTGGG - Intronic
1119003913 14:70907548-70907570 GGGCCGCGGCTCCGGGTGTTAGG + Exonic
1123051865 14:105547911-105547933 GGCCTGCCACTCCGAGTGCGGGG - Intergenic
1126128056 15:45314173-45314195 GGCCGGCGGCTCCGAGTGCAGGG - Intergenic
1129382680 15:75178011-75178033 GGGCAGCGATTCCCAGTCCTGGG - Intergenic
1129724407 15:77894253-77894275 GGCCAGCTGCTCCGAGTGCGGGG + Intergenic
1129913098 15:79244499-79244521 GGGCAGCCAGTGCTAGTGCTTGG - Intergenic
1131250240 15:90825590-90825612 GGCCGGCCTCTCCGAGTGCTGGG - Intergenic
1131912575 15:97224328-97224350 GGCCAGCGGCTCCAAGTGCGGGG - Intergenic
1132316056 15:100891387-100891409 GGGCAGCCACTCCGGATGCTCGG - Intronic
1132880140 16:2158494-2158516 GGGCAGCGACGCAGAGGGCCAGG + Intronic
1132987069 16:2772900-2772922 AGCCAGCCATTCCGAGTGCTGGG - Intronic
1133553076 16:6877516-6877538 GAGCATCGACTCTCAGTGCTTGG + Intronic
1135115331 16:19718594-19718616 GGGCAGCGGCTCCGCGGGCCCGG + Intronic
1135525137 16:23208547-23208569 GAGCAGGGACTGTGAGTGCTTGG - Intronic
1135942705 16:26836335-26836357 GGCCGGCCACTCCGAGTGCGGGG + Intergenic
1137731466 16:50693572-50693594 GGGCTGCGGCTCCGGGTGCGCGG - Intergenic
1139466221 16:67155461-67155483 TTGCAGCGGCACCGAGTGCTGGG + Exonic
1139754682 16:69132710-69132732 GGGAAGCGGCTGCGAGAGCTGGG + Intronic
1140474127 16:75230119-75230141 GGGCCGCTACTCAGAGTGCATGG + Intronic
1143128000 17:4656788-4656810 GGCCAGCCGCTCCGAGTGCGGGG + Intergenic
1143460524 17:7100835-7100857 GGCCGGCCACTCCGAGTGCGGGG + Intergenic
1150237028 17:63601382-63601404 GGGCAGCGGCAGCCAGTGCTGGG - Intronic
1152160779 17:78667314-78667336 GGGCAGGGAGCCCCAGTGCTCGG - Intergenic
1152334791 17:79694649-79694671 GGAGAGAGACTCCCAGTGCTCGG - Intergenic
1154248560 18:12722441-12722463 GGGCAGAGAATCCGAGGGCAGGG + Intronic
1159472968 18:68880274-68880296 GGCCAGCTGCTCCGAGTGCGGGG + Intronic
1160236184 18:77088125-77088147 GGGATGCGTCTTCGAGTGCTGGG + Intronic
1160909459 19:1468067-1468089 GGCCGGCGGCTCCGAGGGCTCGG - Exonic
1160981539 19:1818692-1818714 GGCCAGCGACTCACAGTCCTTGG + Exonic
1165721416 19:38082134-38082156 GGGCAGCGCCCCCGTGTGCCGGG - Exonic
1165995231 19:39839341-39839363 GGGCAGCGACTGCATGTGCATGG - Intronic
1166271909 19:41719655-41719677 GGGCTGTGACTCCCAGTCCTGGG + Intronic
1166378677 19:42343480-42343502 GAGCAGCGCCTCCCAGTGGTCGG + Exonic
1166406109 19:42523034-42523056 GGGCTGTGACTCCCAGTCCTCGG - Intronic
1166983913 19:46648796-46648818 GGGCAGCGACTCCGAGTGCTCGG - Exonic
925068672 2:950268-950290 GCGCTGCGTCTCCAAGTGCTGGG + Intergenic
926444547 2:12926789-12926811 GGTCGGCCGCTCCGAGTGCTGGG + Intergenic
927942203 2:27111747-27111769 GGCCGGCAGCTCCGAGTGCTGGG + Intronic
928399210 2:30965783-30965805 GGGCAGAGAATCAGGGTGCTGGG + Intronic
930039192 2:47107361-47107383 GGCCAGCTGCTCCGAGTGCGGGG - Intronic
935595276 2:104873167-104873189 GGGCAGCGGCTGTGAGCGCTGGG + Intergenic
935878379 2:107536369-107536391 GGCCAGCTGCTCTGAGTGCTGGG + Intergenic
935922536 2:108031645-108031667 AGCCAGCCACTCCGAGTGCGGGG - Intergenic
936922947 2:117707765-117707787 GGGCAGCGACTTGCAATGCTTGG - Intergenic
937181119 2:119997064-119997086 GGCCGGCGGCTCCGAGTGCGGGG - Intergenic
937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG + Intronic
940784620 2:157968150-157968172 GGCCGGCGGCTCCGAGTGCGGGG + Intronic
943857496 2:192816166-192816188 GAGCAGAGAATCCAAGTGCTAGG + Intergenic
944055175 2:195515759-195515781 GGCCGGCGGCTCCGAGTGCTGGG - Intergenic
945869130 2:215207954-215207976 GGACAGCTGCTCCGAGTGCGGGG - Intergenic
946146028 2:217731705-217731727 GGGCTGGGAGTCCGTGTGCTGGG - Intronic
948746011 2:240095137-240095159 GGGCTGCGAGTCCGAGTGTGAGG + Intergenic
1171865152 20:30484130-30484152 GGGCAGCGCCACCGTGTCCTCGG - Intergenic
1172118645 20:32585245-32585267 GGGGAGCGGCCCCGAGCGCTGGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1174152029 20:48492650-48492672 GGGCAGGGACTCCCAATGCACGG + Intergenic
1175836468 20:61998971-61998993 GGGCAGCAAAGGCGAGTGCTGGG - Exonic
1176428986 21:6564707-6564729 GGGGAGCGGTTCCGAGAGCTGGG + Intergenic
1181699410 22:24611380-24611402 GGACAGTGACTCCGAGAGCAGGG + Intronic
1184656791 22:45946005-45946027 GGGCAGCGACTGCGTGCTCTTGG - Intronic
1184727207 22:46354138-46354160 GGACAGCGACGCCCAGAGCTTGG + Intronic
949258956 3:2083713-2083735 GGGCAGCTGCTCCGAGTGGGAGG - Intergenic
950418542 3:12882972-12882994 GGCCAGCAGCTCCGAGTGCGGGG - Intergenic
951323222 3:21271901-21271923 GGCCAGCTGCTCCGAGTGCGGGG + Intergenic
952360452 3:32625721-32625743 GGCCAGCCACTCAGAGTGCGGGG - Intergenic
955210269 3:56934547-56934569 CGGCAGCTGCTCCGAGTGCGGGG - Intronic
956479604 3:69660748-69660770 GGCCAGCTGCTTCGAGTGCTGGG - Intergenic
956563620 3:70611937-70611959 AGCCAGCCACTCCGAGTGCAGGG - Intergenic
956615927 3:71172625-71172647 GGGCAGGGACTCCGAATCCTAGG + Intronic
960941708 3:122939255-122939277 GGGCAGTGACTCTGATAGCTGGG + Intronic
962327538 3:134448087-134448109 AGGCAGGGACTCACAGTGCTTGG + Intergenic
964977740 3:162640151-162640173 GGCCGGCCACTCCGAGTGCGGGG - Intergenic
966725455 3:183104025-183104047 GGCCGGCTACTCCGAGTGCGAGG + Intronic
971564209 4:28117420-28117442 GGCCAGCCGCTCTGAGTGCTGGG + Intergenic
972360960 4:38325195-38325217 GGCCAGCCGCTCCGAGTGCAGGG + Intergenic
975439971 4:74399343-74399365 GGCCAGCCACTCTGAGTGCGGGG + Intergenic
977206499 4:94169926-94169948 GGCCGGCGGCTCCGAGTGCGGGG - Intergenic
977750983 4:100609044-100609066 GGCCGGCGGCTCCGAGTGCGGGG + Intronic
977883581 4:102234420-102234442 GGCCAGCCACTCTGAGTGCAGGG - Intergenic
979290836 4:118977328-118977350 GGCCAGCTGCTCCGAGTGCGGGG + Intronic
979857520 4:125652008-125652030 GGCTGGCCACTCCGAGTGCTGGG + Intergenic
982868829 4:160550396-160550418 GGCCAGCTGCTCCGAGTGCGGGG + Intergenic
985403618 4:189615496-189615518 GGCCAGCCACTCCGAGTGTGGGG + Intergenic
990418949 5:55613433-55613455 GGCCAGCTGCTCCGAGTGCAGGG - Intergenic
991567586 5:68020681-68020703 GGCCGGCGGCTCCGAGTGCGGGG + Intergenic
992006798 5:72486366-72486388 GGGCAGCCAATCTGAGTGCAAGG - Intronic
992321980 5:75622487-75622509 GAGCAGCAACCCCGAGTCCTGGG + Intronic
994239855 5:97407260-97407282 GGCCGGCGGCTCCGAGTGCGGGG - Intergenic
997352201 5:133239069-133239091 TGGCAGCCACTCCGAGTGCGGGG - Intronic
998295313 5:140964541-140964563 TGGCAGCGACTTGGAGGGCTGGG + Intronic
1002318788 5:178362790-178362812 GGGCAGCCTCTCCCAGTGCTTGG - Intronic
1003897028 6:10617295-10617317 GGCCGGCTTCTCCGAGTGCTGGG + Intronic
1004233723 6:13854994-13855016 GGCCGGCTGCTCCGAGTGCTGGG + Intergenic
1004234248 6:13860216-13860238 AGCCAGCCACTCCGAGTGCGGGG - Intergenic
1004370860 6:15051093-15051115 GGGCAGGGATTCAGGGTGCTGGG - Intergenic
1006497908 6:34437276-34437298 GGCCAGCCGCTCCGAGTGCGAGG + Intergenic
1006902819 6:37513913-37513935 GGGCAGGGAGCCCGAGTGATGGG + Intergenic
1009615510 6:65999644-65999666 GGCCAGCGGCTCCGAGTGCAGGG + Intergenic
1014507746 6:122280663-122280685 GGCCAGCTGCTCCGAGTGCAGGG - Intergenic
1014738981 6:125125935-125125957 GGCCGGCCACTCCGAGTGCAGGG - Intronic
1019337488 7:492240-492262 GGTCAGGGAGTCAGAGTGCTTGG - Intergenic
1022793621 7:33714399-33714421 TGGCAGCCTCTCCCAGTGCTAGG - Intergenic
1023000279 7:35801302-35801324 GGTCAGCGGCTCCGAATGCCGGG + Intronic
1024443839 7:49453777-49453799 GGCCGGCCACTCCGAGTGCGGGG - Intergenic
1024889702 7:54185858-54185880 GGGCAGCAGCTCCAACTGCTTGG - Intergenic
1028912972 7:96228789-96228811 GGCCATCCACTCCGAGTGCAGGG - Intronic
1029037902 7:97541292-97541314 GGCCAGCCACTCTGAGTGCAGGG - Intergenic
1029407074 7:100381810-100381832 GGCCGGCCACTCCGAGTGCGGGG - Intronic
1034745929 7:153524052-153524074 GGGCAGAGACTGGGAGCGCTTGG - Intergenic
1036851321 8:12203642-12203664 GGTGAGCCACTCCGAGTGCAGGG + Intergenic
1036872685 8:12445916-12445938 GGTGAGCCACTCCGAGTGCAGGG + Intergenic
1036952535 8:13154476-13154498 GGCCAGCTGCTCCGAGTGCGGGG + Intronic
1041914510 8:63126191-63126213 GGCCAGCTGCTCCGAGTGCGGGG - Intergenic
1042200477 8:66275872-66275894 GGACAGTGACTCCGGGGGCTGGG - Intergenic
1042948775 8:74179795-74179817 GGCCAGCGGCTCCGAGTGCGGGG + Intergenic
1043388535 8:79769696-79769718 GGCCGGCCACTCAGAGTGCTTGG - Intergenic
1044088471 8:87971229-87971251 GGCCAGCCACTCCGAGTGCGGGG - Intergenic
1044853566 8:96452414-96452436 GGCCGGCCGCTCCGAGTGCTGGG - Intergenic
1045467781 8:102485790-102485812 GGCCAGCTGCTCCGAGTGCGGGG + Intergenic
1046661217 8:116950014-116950036 GGCCGGCGGCTCCGAGTGCGGGG + Intergenic
1056799421 9:89681176-89681198 GGCCAGCCACTCTGAGTGCGGGG - Intergenic
1060409261 9:123389339-123389361 AGGCAGCGAGTCCCAGTGCTGGG + Intronic
1060524757 9:124314185-124314207 AGGCAGCGACCCCAAGGGCTGGG - Intronic
1062080006 9:134618821-134618843 GGGCAGCGAGGCCGAGTGAGAGG + Intergenic
1186293172 X:8121670-8121692 GGCCAGCCTCTCCGAGTGCGGGG - Intergenic
1186770706 X:12815419-12815441 GGGCAGTGCTTCCCAGTGCTGGG + Intronic
1191053925 X:56222831-56222853 GGCCGGCGGCTCCGAGTGCGGGG + Intergenic
1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG + Intergenic
1191252056 X:58264432-58264454 CAGCAGCTACTCCGAGGGCTAGG + Intergenic
1192022447 X:67408742-67408764 GGCCAGCCACTCAGAGTGCGGGG - Intergenic
1194890499 X:99372315-99372337 GGCCTGCTGCTCCGAGTGCTGGG + Intergenic
1197978738 X:132194167-132194189 GGCCAGCCACTCCGAGTGTGGGG - Intergenic
1198060896 X:133044458-133044480 GGCCAGCCACTCTGAGTGCAGGG - Intronic