ID: 1166988252

View in Genome Browser
Species Human (GRCh38)
Location 19:46675158-46675180
Sequence AGGGTCACTCCTCCTCCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166988252 Original CRISPR AGGGTCACTCCTCCTCCAAT AGG Intronic
900931834 1:5742804-5742826 TGGGTCACTGCTCCTGCACTCGG - Intergenic
901468558 1:9439738-9439760 AGGGTCAGTCCACCTGCCATAGG + Intergenic
911142006 1:94514155-94514177 TGGGTCACTGTTCCTCCAAGTGG - Intronic
914410704 1:147424166-147424188 AGTGCCTCTCCTCCTCCAAAGGG + Intergenic
921275275 1:213512950-213512972 AGGGTCATTCTTCCTACCATAGG - Intergenic
923090289 1:230735535-230735557 AGGGGCAGGCCTCCTCCAAGTGG - Intergenic
924386878 1:243507267-243507289 AGAGTCCCTCCTCTTCCAAAAGG - Intronic
1066813502 10:39372168-39372190 AGTGCCTCTCCTCCTCCAAAGGG - Intergenic
1068639594 10:59388367-59388389 AAGGTCACTCCTGATCTAATAGG - Intergenic
1069833554 10:71295126-71295148 GGGGACACTCCTTCTCCCATGGG - Intronic
1069840429 10:71336225-71336247 GGGGTCATTCCTCCTCCAGTAGG + Intronic
1075574421 10:123568562-123568584 AGAGCCAGTCCTGCTCCAATCGG + Intergenic
1076446297 10:130516543-130516565 ACGCTGACTCCTCCTCCCATTGG - Intergenic
1078190166 11:9087602-9087624 AGGACCACACCTTCTCCAATGGG + Intronic
1078717460 11:13853720-13853742 TGGGTCTCTCATCCTCCAGTAGG - Intergenic
1079956976 11:26878318-26878340 AAGGTCCCTCCTCCTACATTGGG + Intergenic
1084443171 11:69187558-69187580 AGGGTCACTCTTCCTCTCAAAGG - Intergenic
1085026602 11:73240111-73240133 CTGGCCACTCCTCCTCCAATGGG + Intergenic
1089584209 11:119499769-119499791 AGGAACACTCTTCCACCAATTGG - Intergenic
1089988577 11:122836624-122836646 AGGGTCACTCTTCCTCCATAGGG - Intergenic
1090615485 11:128510565-128510587 AGTGTGTCTCCTCCTCCAATTGG - Intronic
1091826176 12:3514506-3514528 AGGGTCACCCTGCCTCCAAGTGG + Intronic
1098400684 12:70072113-70072135 CGTGTAAATCCTCCTCCAATAGG - Intergenic
1098421031 12:70298270-70298292 AAGGACCTTCCTCCTCCAATCGG + Intronic
1099149524 12:79092022-79092044 AGGGTGACTCCTCCTTGGATTGG - Intronic
1101850944 12:108401817-108401839 AGTGTCACTCCTCCTCCCAGGGG - Intergenic
1105939334 13:25133216-25133238 AGGAACACACCTCCTCCCATGGG - Intergenic
1106401281 13:29433542-29433564 AAGGTCAATCCACCTCCTATGGG + Intronic
1106419896 13:29577436-29577458 AGTGTCACTTCTCCTACACTGGG - Intronic
1106850536 13:33785699-33785721 AGGGTCACTCCTGTTGCAAAGGG + Intergenic
1107736020 13:43399402-43399424 GTTGTCACTTCTCCTCCAATAGG + Intronic
1110646076 13:77886060-77886082 AAGGTGACTCCTCCTCTAAAGGG - Intergenic
1112134736 13:96564513-96564535 AGAGTCACTCCTAGTCAAATAGG - Intronic
1117549345 14:56817959-56817981 AGGGTCCTTCCTCCTCCACGAGG - Intergenic
1119111694 14:71981315-71981337 AGCGCCTCTCCTCCTCCAAAGGG - Intronic
1120987894 14:90350204-90350226 TGGCTCTCTCCTCCTCCAAAAGG + Intergenic
1124899702 15:33810719-33810741 AGGGTTAGTCCTCCTCCCCTGGG + Intronic
1135358640 16:21792139-21792161 ATGGTCTCTCATCCTCCATTAGG + Intergenic
1135457196 16:22608575-22608597 ATGGTCTCTCATCCTCCATTAGG + Intergenic
1135818316 16:25656273-25656295 CGAGTCCCTCCTCCTCCAAGAGG - Intergenic
1138549850 16:57741617-57741639 AGGGTCACCCCTCCTTCACAAGG + Intronic
1139357095 16:66372885-66372907 AGGGCCCATCCTCCTCCATTTGG + Intronic
1141794724 16:86263119-86263141 AGTGCCTCTCCTCCTCCAAAGGG + Intergenic
1142889254 17:2932359-2932381 AGTCTCCCTCCTCCTCCACTGGG - Intronic
1145052716 17:19676079-19676101 GGGGTTACTCCTCCTCCAATGGG + Exonic
1157415537 18:47499558-47499580 AAGGTGACTGCTCCACCAATGGG - Intergenic
1158661526 18:59392856-59392878 AGGGTCCCTCCTCTGCCAACAGG + Intergenic
1162099883 19:8333349-8333371 AAGGTCACTCCTCGTCCAGGTGG + Intronic
1166988252 19:46675158-46675180 AGGGTCACTCCTCCTCCAATAGG + Intronic
1167197631 19:48041640-48041662 AGGGTCACCCATTCTCCAAAGGG + Intronic
930091670 2:47535434-47535456 AGGTGCACCCCTCCTCTAATGGG + Intronic
930523050 2:52492152-52492174 AGTGTCTCTTCTCCTCCAAATGG - Intergenic
941372459 2:164682604-164682626 AGGGTCACTCCTCAAAGAATAGG + Intronic
943893920 2:193329041-193329063 AGGGTGAATCCTAATCCAATAGG + Intergenic
944996469 2:205300489-205300511 AAGGTCACCCCTCTTCTAATGGG - Intronic
948053732 2:234996506-234996528 AGGGTCAGTCCTCCGCCCACTGG + Intronic
1169917957 20:10702543-10702565 ATGGTCTCTCATCCTCCAACAGG - Intergenic
1170738485 20:19031666-19031688 AGGATCACCGCTCCTCCAATTGG + Intergenic
1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG + Intronic
1173573013 20:44090256-44090278 AGGGTCTCTCATCATCCAACAGG - Intergenic
1175026157 20:55905298-55905320 AGTGCCTCTCCTCCTCCAAAGGG - Intergenic
1175536568 20:59718917-59718939 AGCGTCTCTGCTCCTCCAAGTGG + Intronic
1177332306 21:19680049-19680071 AGGGTCACGCCTGCTGTAATGGG + Intergenic
1177912756 21:27052801-27052823 AGGGCCTCTTCTCCTCCAAATGG + Intergenic
1179640881 21:42746533-42746555 AGGGTGACCCCTACTCCAATAGG - Intronic
1181468838 22:23125752-23125774 AGCGTCTCTGCTCCTCCAGTGGG - Intronic
950592769 3:13950718-13950740 AGGGACAGTCCTCATCCATTTGG - Intronic
952490389 3:33865502-33865524 AGGGTCATCCCTTCTCCAAATGG + Intronic
952633807 3:35503015-35503037 AGGGATAATCCTCATCCAATAGG + Intergenic
952843327 3:37666559-37666581 ATGGTCTCTCCTCCTCCAGCAGG + Intronic
956738081 3:72254163-72254185 GGGGTCTCTCATCCTCCAGTAGG - Intergenic
957127750 3:76184280-76184302 ATAGTCTCTCCTCCTCCAGTGGG + Intronic
957762362 3:84574251-84574273 AGGGTCACCCATCCACAAATGGG + Intergenic
960140046 3:114142904-114142926 AGTGTCACTCTGCCTGCAATGGG - Intronic
960293235 3:115912403-115912425 GGGGTCCCTCCTCCTCCCAGTGG - Intronic
971312439 4:25537022-25537044 AAAGTCACTCCTTCTCCCATGGG + Intergenic
971734733 4:30432365-30432387 AAATTCACTCCTCCTCCCATTGG + Intergenic
976077620 4:81317509-81317531 AGGGTCTCACCTTCTCCAAATGG + Intergenic
977699485 4:100005583-100005605 AGCGCCTCTCCTCCTCCAAAGGG - Intergenic
978165442 4:105601590-105601612 AGGGTAAATACTCCTCCCATAGG - Intronic
983523685 4:168737983-168738005 ATGGACAGTCCTCCTCCAAGGGG - Intronic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985571144 5:646004-646026 AGCGTCACTCTTGCTCCCATCGG + Intronic
985571151 5:646069-646091 AGCGTCACTCTTGCTCCCATTGG + Intronic
985758172 5:1731467-1731489 AGGGTCACTCATCCTCCTTGAGG - Intergenic
987979753 5:25067667-25067689 AAGGTCATTCCTACTCCAAAGGG - Intergenic
988891843 5:35625865-35625887 AGGGTTCCTTCTGCTCCAATGGG - Intronic
993289044 5:86041182-86041204 AGAGTCAACCCTCATCCAATGGG + Intergenic
995888442 5:116922120-116922142 AGGGTCACACTTCCTCCAAAGGG - Intergenic
998931906 5:147190588-147190610 ATGGTCACTCATCCTCCAATAGG + Intergenic
1000219022 5:159193840-159193862 AAGGTCACTCCTCTTAGAATTGG + Intronic
1001239561 5:170057689-170057711 AGGGCCACCCTTCCTCCGATGGG + Intronic
1005836275 6:29711820-29711842 AGGGTCCTTCCTCCTGGAATAGG - Intergenic
1008576166 6:52861902-52861924 AGCGCCTCTCCTCCTCCAAAGGG + Intronic
1008944507 6:57083052-57083074 AGGGGCTCTCCTCTTCCATTGGG - Intergenic
1012525954 6:100177931-100177953 AAGGTCAGTCCCCCTACAATAGG - Intergenic
1013386326 6:109635459-109635481 AGAGCCACTCCTACTCCACTTGG + Intronic
1016517919 6:144917125-144917147 AGGTTGACTTCTTCTCCAATAGG - Intergenic
1017838766 6:158204573-158204595 GGGGTCACTGCTCCTCCGAGTGG - Intergenic
1019664329 7:2243888-2243910 AGGGTCCTTCCTGCTCCCATAGG - Intronic
1023722006 7:43105685-43105707 ATGGTCACTCATCCTGTAATAGG - Intergenic
1024993918 7:55256299-55256321 AGGGTCACTGGTCCTCAAAGCGG + Intronic
1026364559 7:69634725-69634747 GTGGTCACTCCTACTCCCATTGG + Intronic
1037744885 8:21635192-21635214 TGGGTCACTGCTCCTCACATTGG + Intergenic
1038261918 8:26003097-26003119 TGGGTCACTTGTCCTCCAAGAGG + Intronic
1040656675 8:49518687-49518709 ATGGACACTGCTCCTCCAAATGG + Intergenic
1041637644 8:60161444-60161466 AGCGCCTCTCCTCCTCCAAAGGG + Intergenic
1047623864 8:126635719-126635741 ACTGTCCCTCCTCCTCCAAAAGG + Intergenic
1048840874 8:138564755-138564777 AGGATCACTTCTTCACCAATGGG + Intergenic
1048938043 8:139373258-139373280 TGAGTTACTCCTCCTCCTATGGG - Intergenic
1051021512 9:12549162-12549184 AGGATCCCTCCTTCACCAATAGG + Intergenic
1057184572 9:93049754-93049776 AGGGTGTCTCCTGCTCCACTGGG + Intergenic
1058333144 9:103790233-103790255 AGGGTCCCTTCTCCAACAATGGG - Intergenic
1060890641 9:127185967-127185989 AAGGTCACTCATCCTGCAAATGG + Intronic
1061914577 9:133742765-133742787 TGGGTCACTCCTACTCCAGCTGG + Intergenic
1186886010 X:13914589-13914611 AGGGACACTCCTCCCCAAAGGGG - Intronic
1186926402 X:14337307-14337329 ATGGTCTCTCATCCTGCAATAGG + Intergenic
1187293927 X:17980970-17980992 GGGGTCACTCCTCCCACAAGAGG - Intergenic
1188642905 X:32528515-32528537 AGGCTAACTCCCCCTCCAAAGGG + Intronic
1192527145 X:71856967-71856989 AGCCTCATTCCTCCTCCAAGAGG - Intergenic
1193062483 X:77221020-77221042 AGTGTCTCTTCTCCTCCAAATGG + Intergenic
1198071230 X:133150502-133150524 GGGGTCTCTCATCCTCCAGTGGG - Intergenic
1199072160 X:143489753-143489775 AAGGTCACACCTCCTCCATGAGG + Intergenic
1201289236 Y:12406726-12406748 AGGGTCACCTCTCCCCCAAGAGG - Intergenic