ID: 1166989857

View in Genome Browser
Species Human (GRCh38)
Location 19:46685623-46685645
Sequence AAAGGAATCATGGTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166989857_1166989859 -6 Left 1166989857 19:46685623-46685645 CCTGTGAGAACCATGATTCCTTT 0: 1
1: 0
2: 2
3: 12
4: 224
Right 1166989859 19:46685640-46685662 TCCTTTCCACACCTGAAGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 158
1166989857_1166989862 0 Left 1166989857 19:46685623-46685645 CCTGTGAGAACCATGATTCCTTT 0: 1
1: 0
2: 2
3: 12
4: 224
Right 1166989862 19:46685646-46685668 CCACACCTGAAGTCTGGATGTGG 0: 1
1: 0
2: 0
3: 22
4: 181
1166989857_1166989866 13 Left 1166989857 19:46685623-46685645 CCTGTGAGAACCATGATTCCTTT 0: 1
1: 0
2: 2
3: 12
4: 224
Right 1166989866 19:46685659-46685681 CTGGATGTGGCCGGGCACGATGG 0: 1
1: 1
2: 8
3: 143
4: 996
1166989857_1166989863 4 Left 1166989857 19:46685623-46685645 CCTGTGAGAACCATGATTCCTTT 0: 1
1: 0
2: 2
3: 12
4: 224
Right 1166989863 19:46685650-46685672 ACCTGAAGTCTGGATGTGGCCGG 0: 1
1: 0
2: 1
3: 19
4: 186
1166989857_1166989865 5 Left 1166989857 19:46685623-46685645 CCTGTGAGAACCATGATTCCTTT 0: 1
1: 0
2: 2
3: 12
4: 224
Right 1166989865 19:46685651-46685673 CCTGAAGTCTGGATGTGGCCGGG 0: 1
1: 0
2: 3
3: 21
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166989857 Original CRISPR AAAGGAATCATGGTTCTCAC AGG (reversed) Intronic
902704157 1:18192969-18192991 ACTGGAATCCTGGTCCTCACAGG + Intronic
903300779 1:22377137-22377159 AGAGGAATCAGGGATCTGACTGG - Intergenic
906577525 1:46904164-46904186 AAAGGAATCATCATTCATACTGG + Intergenic
907829281 1:58048816-58048838 CACGGAATCATGGTTGTCAAAGG + Intronic
908155406 1:61347629-61347651 AAAGGAGTCATGGATCCCATTGG - Intronic
912441984 1:109706071-109706093 AAAGGTATCATAGTTCATACTGG + Intronic
914745639 1:150499098-150499120 ACAGTAATCAAGGTTCTCAGAGG + Intronic
917223376 1:172755778-172755800 AAAGGAATTGATGTTCTCACCGG + Intergenic
918463972 1:184803031-184803053 CTCGCAATCATGGTTCTCACTGG + Intronic
918916391 1:190645344-190645366 AAAGGAGTCATTATTATCACGGG - Intergenic
920294875 1:204949938-204949960 ATAGAAATCATGCTTCTCAATGG - Intronic
921064021 1:211610009-211610031 AAAGGATTAGTGGTTCCCACTGG - Intergenic
923344965 1:233042703-233042725 GAAGAAATCAAGGTTCTGACAGG + Intronic
923474524 1:234320502-234320524 AAAGGCATCTTGATTCTAACTGG + Intronic
1063389376 10:5639317-5639339 AAAGGGAACGTGGTACTCACTGG - Exonic
1064013195 10:11752518-11752540 ATATTAATCATGGTTCTCTCTGG - Intronic
1064463708 10:15558976-15558998 AAAGAAATCATAATTCTCAAGGG - Intronic
1064948185 10:20816427-20816449 AAAGCCAGCATGCTTCTCACTGG + Intronic
1066081673 10:31937051-31937073 AGAGGAAGCATTGTTCTCTCAGG - Intergenic
1068064213 10:52108806-52108828 AAAGGAATACTTGTTCTCCCAGG - Intronic
1069318228 10:67134928-67134950 CTAGGAATCATGGGTCTCAGCGG - Intronic
1069333489 10:67321050-67321072 AAAGAAATCAAGATTCTTACAGG - Intronic
1070538561 10:77399112-77399134 AAAGGGATCATGTCTCTCAGTGG - Intronic
1072099591 10:92216557-92216579 AAAGGGATCATGGTTTTGGCAGG + Intronic
1072319054 10:94231273-94231295 GAATGAGACATGGTTCTCACTGG - Intronic
1073608695 10:104921953-104921975 AAAGTAATTATCCTTCTCACTGG - Intronic
1074808377 10:117077371-117077393 AAGGAAATCAAGGTTTTCACTGG + Intronic
1075930913 10:126294726-126294748 AATGGAATTTTGGTTCTTACTGG - Intronic
1078621476 11:12912646-12912668 AATGAAATCATGGATTTCACAGG + Intronic
1079311679 11:19372164-19372186 AAAGGCATCATGTTTCTCTTGGG + Intronic
1080178256 11:29393115-29393137 AAAGGAAACTTCATTCTCACTGG + Intergenic
1080293591 11:30699571-30699593 AAAAGAATAATGGTTATCAGGGG + Intergenic
1083168531 11:60907193-60907215 ATAGCAATCATGGCTATCACAGG + Intergenic
1085927016 11:81034914-81034936 AAAGGAATTAATGTGCTCACTGG + Intergenic
1086166205 11:83781690-83781712 AAAGAATTTGTGGTTCTCACAGG + Intronic
1086372132 11:86165403-86165425 AGTGGAAACATGGTCCTCACAGG - Intergenic
1087245396 11:95829777-95829799 ATATGAATCATGTTTCTCTCTGG - Intronic
1090493072 11:127182932-127182954 AAAGGAATCAGAGTGATCACAGG + Intergenic
1091063660 11:132488771-132488793 AGAGGTATCATGGTTTTCATTGG + Intronic
1095382594 12:41613861-41613883 AAAGGCATCAGGTTTCTCAGAGG + Intergenic
1097012973 12:55966418-55966440 AAAGGAATCCTGGGCCTCAGAGG - Intronic
1099623298 12:85032050-85032072 AAAAGAATAATGGTAATCACTGG + Intronic
1100226725 12:92564626-92564648 TAAGGAAACATGGTTCCCATAGG + Intergenic
1103684420 12:122720462-122720484 GAAGGAAGCATGGTATTCACAGG - Intergenic
1104367379 12:128190601-128190623 AAAGGAATCATATTTGTAACAGG - Intergenic
1106475802 13:30096963-30096985 AAAGGGGTCAAGGTACTCACGGG + Intergenic
1107788449 13:43977591-43977613 AAAGGAATCAGGGTTGCTACTGG - Intergenic
1108185062 13:47880480-47880502 AGAGGAATCCTGTGTCTCACTGG + Intergenic
1108492674 13:50996944-50996966 AAAGAAATCATGGTGCTCTCAGG - Intergenic
1109185278 13:59260568-59260590 AAAAGAATCAGGGTTCTAAGTGG + Intergenic
1109721731 13:66283850-66283872 AAAGGATTCATGGTGCTGCCTGG - Intergenic
1110028985 13:70581209-70581231 AAAGAGATCATGCTTCTCCCTGG - Intergenic
1113951103 13:114071277-114071299 ATAGAAATCATGGTTCTGGCCGG - Intronic
1114254403 14:20989341-20989363 ACAGAAAACATGGTTCTGACGGG - Intergenic
1114622300 14:24103466-24103488 TAAGGAATCTTCCTTCTCACTGG - Intronic
1116349456 14:43841672-43841694 AATGGAATGATGGTTGTCATGGG - Intergenic
1116978336 14:51140859-51140881 AAAGTCACCATGGTTCTCCCTGG + Intergenic
1116980780 14:51167816-51167838 CCAGGAATCATGTTTCTCCCTGG - Intergenic
1117518855 14:56530269-56530291 AGATGACTCCTGGTTCTCACGGG - Intronic
1117816637 14:59605695-59605717 ACAGAAAGCATGGTTCTCAGTGG + Intronic
1118917168 14:70117271-70117293 AAAGGAATCATGCTAGTCACTGG - Intronic
1120103110 14:80466659-80466681 AAAGGAATTAATGTGCTCACTGG + Intergenic
1120616525 14:86712425-86712447 AAAGGAATCTTATTTCTCAAAGG - Intergenic
1120969010 14:90191980-90192002 AAAGGAGTGATGGGCCTCACTGG + Intergenic
1121031725 14:90664071-90664093 AAAGGAATGTGGGTTGTCACTGG + Intronic
1124503326 15:30249909-30249931 GAAAGATTCATGGTCCTCACGGG + Intergenic
1124740229 15:32288730-32288752 GAAAGATTCATGGTCCTCACGGG - Intergenic
1125987488 15:44068821-44068843 AATGGAATCATGATTTTCTCAGG + Intronic
1126622875 15:50657486-50657508 AAAGACATCATGGTTCTGTCAGG - Intronic
1126763797 15:51993466-51993488 GCAGGAATCAAGTTTCTCACTGG + Intronic
1127259519 15:57317991-57318013 AAAGAAACGATGGTTCTCTCTGG - Intergenic
1129771363 15:78205358-78205380 ACAGGAATCAGGGTTCACTCTGG - Intronic
1129961098 15:79685338-79685360 GAAGAAATCATTGTTATCACAGG - Intergenic
1132025074 15:98398447-98398469 AAAGGAATAATGGGGCTTACTGG + Intergenic
1132036053 15:98485939-98485961 AAAGGAATCCTGGTGCTCCACGG - Exonic
1132356825 15:101177754-101177776 AAAGGCAAAATGGTTGTCACTGG + Exonic
1135066694 16:19316111-19316133 AAAGGAATCTTGTGTCTCCCAGG - Intronic
1138273345 16:55712049-55712071 AACAGAATCATGGTTCTCTTAGG + Intergenic
1138309857 16:56014344-56014366 AAAGGGATCTAAGTTCTCACAGG + Intergenic
1140724292 16:77798223-77798245 AAAGGAATCATTGTCATCCCTGG - Intronic
1140969868 16:80002623-80002645 AAAATAATCATGGTTCACATGGG + Intergenic
1141170084 16:81685431-81685453 AGAGGAATCAGGGTCCCCACGGG - Intronic
1142280235 16:89144253-89144275 GAAGGAAGCTTGGTTCCCACAGG + Intronic
1147438956 17:40435555-40435577 AATGGATTCATTGTTATCACAGG - Intergenic
1149473243 17:56936756-56936778 AAAGAATTCCTGATTCTCACTGG - Intergenic
1152140311 17:78532635-78532657 AAAGGAATCCTGGTACTCCTCGG + Exonic
1153905227 18:9655202-9655224 AAATGAATCATTGTTCAAACAGG - Intergenic
1155770682 18:29694585-29694607 GAAGGAATCAGGGATCTCAGTGG - Intergenic
1156271464 18:35537266-35537288 AAAGTTATCATGGTTTTAACTGG - Intergenic
1159724682 18:71942192-71942214 AAAGGGATCAGGTTTCACACTGG - Intergenic
1159892696 18:73967500-73967522 AAAGGAATCATTGTGATAACAGG + Intergenic
1159916718 18:74194552-74194574 AAAGGAATCAAGGTGTCCACAGG + Intergenic
1161124677 19:2549122-2549144 ACAGGAGTCAGGGTTCTCTCCGG - Intronic
1162275604 19:9651757-9651779 ATAGGAATAATGTTTATCACAGG + Intronic
1163274471 19:16274622-16274644 AGAGGAAGCATGGTTGCCACCGG + Intergenic
1164056167 19:21623738-21623760 AAAGGAGTCAATGTGCTCACTGG + Intergenic
1164778662 19:30874229-30874251 AACGGCAGCATCGTTCTCACTGG - Intergenic
1165072782 19:33265202-33265224 ACAGGTACCATGGTTCACACAGG + Intergenic
1165170462 19:33888390-33888412 AAAGTAATCATGTATCTCACGGG - Intergenic
1166217707 19:41346704-41346726 AAAGAAATCCTCATTCTCACTGG - Intronic
1166989857 19:46685623-46685645 AAAGGAATCATGGTTCTCACAGG - Intronic
925494130 2:4426804-4426826 AAAAGAATAATTGTACTCACAGG - Intergenic
925651339 2:6092764-6092786 AAAGCAATCATGTGTCGCACTGG + Intergenic
927081662 2:19636471-19636493 AAATGGATCTTGGTTTTCACAGG - Intergenic
927925412 2:27009803-27009825 AAAGGAAACATGGTTTGAACTGG - Intronic
929691244 2:44075749-44075771 AATTGCATCATGGTTCTCCCTGG + Intergenic
931203009 2:60118743-60118765 AAAGGAACCAGGGGTCTCCCTGG + Intergenic
932639129 2:73424900-73424922 AAAAGAATCAGGGTACTTACTGG - Exonic
933081505 2:77993584-77993606 AAATAAATCATGGGTGTCACGGG - Intergenic
935125922 2:100222886-100222908 ACAGGAATGATGGATCACACTGG - Intergenic
937796853 2:126033577-126033599 AAAGAATTCATGCTTCTCATTGG + Intergenic
937949406 2:127372160-127372182 AAAGGAATCAATGTGCTCACTGG + Intronic
938544957 2:132319764-132319786 AAATGAATGAAGGTTATCACTGG - Intergenic
939329614 2:140740418-140740440 AAATCAAACATTGTTCTCACTGG + Intronic
940110672 2:150148937-150148959 AAAGCAATCTTGGGTCTCAAAGG + Intergenic
940660297 2:156537113-156537135 AAAGGAATCCCTGTGCTCACAGG - Intronic
943563270 2:189488547-189488569 AAAGAAAGCATTGTTATCACAGG + Intergenic
944697797 2:202218452-202218474 AGTAGAATCATGGTTGTCACTGG + Intronic
945406413 2:209454249-209454271 AAAGGAATCATTCTTCTTTCTGG + Intronic
947032140 2:225808395-225808417 ACAGAAATCATAGCTCTCACAGG - Intergenic
947226865 2:227849078-227849100 AAAGGAATCAGGGATTTCATAGG + Intergenic
1169524480 20:6408482-6408504 AATTGGATCATGGTTCTAACAGG - Intergenic
1169740702 20:8890711-8890733 AAAGAATTAATGGTTTTCACGGG - Intronic
1169811605 20:9614198-9614220 AAATGAAGGATGCTTCTCACGGG + Intronic
1170050963 20:12144904-12144926 CAAGCAACCATGGATCTCACTGG - Intergenic
1170511611 20:17083509-17083531 GAAGGCCTCATGGTTGTCACTGG + Intergenic
1171155053 20:22864431-22864453 AAAGGAATCTGGGTTAACACAGG - Intergenic
1171277853 20:23873917-23873939 AAAGGAAAAAAGGTTATCACAGG - Intergenic
1171950996 20:31421857-31421879 AAAGGGCTCATGGGTTTCACTGG - Intergenic
1175392558 20:58636268-58636290 GAAGGAAGCAGGGTTCTCACTGG + Intergenic
1176166702 20:63678065-63678087 CCAGGAATCCTGGTTCTCAAGGG + Intronic
1179417043 21:41207407-41207429 AAAAGGATCATTGTTTTCACTGG + Intronic
1179565648 21:42246265-42246287 AGAGGAATGATAGTTGTCACTGG + Intronic
1181506234 22:23359952-23359974 GAAAGAATCATGGTTCTTCCAGG - Intergenic
1181682816 22:24507586-24507608 AAAGGAGTAAAGGTTCTCAGTGG + Intronic
1183189739 22:36314125-36314147 AAAGCAAGCCTGGTACTCACTGG + Exonic
1184792817 22:46710941-46710963 AAAGTAAACATGCTTCTTACAGG - Intronic
949426362 3:3921066-3921088 TTAAGAATCATGGTTCTCAGAGG + Intronic
952986727 3:38792199-38792221 TAAGGAATCTTGTTTCTCATTGG - Intronic
957458803 3:80490005-80490027 AAAGGAAACTTTCTTCTCACAGG + Intergenic
959564623 3:107821818-107821840 CAAGGAATCAGGTTTATCACAGG + Intergenic
959564628 3:107821845-107821867 CAAGGAATCAGGTTTATCACAGG + Intergenic
960344998 3:116520037-116520059 AAAAGAATCATCATTCTGACTGG + Intronic
962106438 3:132395438-132395460 AGAGGAATCATGGATCCCAGGGG + Intergenic
962685245 3:137841541-137841563 TGAGGAATCATGGTTCCCAGTGG - Intergenic
963313288 3:143731630-143731652 AAGAGAATCATGTTTGTCACGGG - Intronic
964800232 3:160548473-160548495 AAAGGAATAATGGTTGCCAGGGG - Intronic
965430184 3:168577240-168577262 AAAGAAATAATTGTTGTCACTGG + Intergenic
966681085 3:182642815-182642837 AGAGGAATAATGATTCTCTCTGG + Intergenic
969397651 4:6933175-6933197 AAAGCAATCAGTGTTCTCTCTGG - Intronic
970066947 4:12106173-12106195 AAAGAAATGAAGGTTTTCACTGG - Intergenic
972885230 4:43477001-43477023 AAGGGAATCATGGATCCCAGTGG - Intergenic
973019249 4:45179763-45179785 AAAAGGATAATGGTTCTCATTGG + Intergenic
973038441 4:45438612-45438634 AAAGAAATCAAGCTTCTAACAGG - Intergenic
973066694 4:45804309-45804331 AATGGAAGCATGGGTCACACCGG - Intergenic
973765990 4:54163333-54163355 AAAGGAATCATTGATCCCACGGG - Intronic
974998717 4:69194782-69194804 AAAGGTATCATAGTTCCTACTGG + Intronic
976191158 4:82488534-82488556 AAAGGAATCAAGGTTCCTAAAGG - Intronic
976612305 4:87042543-87042565 AAAGACATCATGGATATCACTGG - Intronic
978203521 4:106051180-106051202 AACAGAATCATGTCTCTCACTGG + Intronic
979617025 4:122754564-122754586 AAAGGAGTCAAGGGTCCCACAGG + Intergenic
980526350 4:133994852-133994874 AAAGGAATCAGTGTGATCACAGG - Intergenic
980816233 4:137950092-137950114 AAACCAATCCTAGTTCTCACTGG - Intergenic
981045715 4:140263263-140263285 CAAGGTCTCATGCTTCTCACAGG - Intronic
983190513 4:164749260-164749282 AAAGGTATCATAGTTCATACTGG + Intergenic
985044377 4:185925491-185925513 AAAGTTATAATGGTTCTCTCTGG - Intronic
989024333 5:37048899-37048921 AAAGAGATTATAGTTCTCACTGG + Intronic
989281239 5:39646059-39646081 AAAAGAAACATGGGTCTCACAGG + Intergenic
993681245 5:90880941-90880963 ACAGGATTCATGGTTCTGTCTGG + Intronic
997090900 5:130856223-130856245 CAAGGAATTATGGTTTTCAGAGG - Intergenic
998827494 5:146118332-146118354 AATAGAATCATGGTTATCAGAGG + Intronic
1000244454 5:159437848-159437870 AGAGGATTCATAGTTGTCACAGG + Intergenic
1000618100 5:163452082-163452104 ATAGGAATCAGGTTTCTCACTGG + Exonic
1001781421 5:174372101-174372123 AAAGGAAATATTTTTCTCACAGG - Intergenic
1002005863 5:176234238-176234260 AATGGAATAATGGTTTTCAGGGG - Intergenic
1002902546 6:1422318-1422340 AAAGGAGTTCTGGTTCTCAGTGG + Intergenic
1003764841 6:9223764-9223786 AAAGGACTCATTGACCTCACAGG + Intergenic
1005185960 6:23163211-23163233 AAAGGAATTAATGTGCTCACTGG + Intergenic
1006280809 6:33051508-33051530 AAAGGAATTAATGTGCTCACTGG + Intergenic
1007194236 6:40046625-40046647 AAAGATAAAATGGTTCTCACAGG + Intergenic
1008540939 6:52546002-52546024 AACAGAATCATCATTCTCACAGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009610613 6:65936467-65936489 ACAGCAATCATCCTTCTCACAGG + Intergenic
1010617204 6:78028603-78028625 TAAGGAATTATGGATGTCACTGG - Intergenic
1010853903 6:80813837-80813859 AATGGAATTATGGTGTTCACTGG - Intergenic
1011152871 6:84293834-84293856 AAGAGAATCATGGTTCTCAGGGG - Intergenic
1011564074 6:88656642-88656664 AGAGGGTTCATGGTTTTCACAGG + Intronic
1012274877 6:97260973-97260995 AAATGAATCATGGTACCCATTGG - Intronic
1016513120 6:144865162-144865184 AGAGGATTCCTGGATCTCACTGG - Intergenic
1017239979 6:152157168-152157190 AAAGGTAACATGGTTATCAATGG + Intronic
1017632601 6:156411726-156411748 ACAGAAATCAGTGTTCTCACTGG + Intergenic
1020960699 7:14798704-14798726 ACAGGACTTATGGTTCTCAGTGG + Intronic
1024111031 7:46146308-46146330 AAAGTGAGCAGGGTTCTCACTGG + Intergenic
1024154381 7:46605394-46605416 AAAGGCACCAGGGTTCTCACAGG - Intergenic
1024295926 7:47842365-47842387 AAAGTAACCATGGTTCCCTCGGG + Intronic
1024587265 7:50853085-50853107 AAAGGAATGTGGGTCCTCACTGG + Intergenic
1030335101 7:108317282-108317304 AAATGAAATATTGTTCTCACTGG + Intronic
1030496613 7:110308733-110308755 AATAGAATCATGGTTATCAGGGG - Intergenic
1031156375 7:118116362-118116384 AAAGGAATTAATGTGCTCACTGG + Intergenic
1031267243 7:119596708-119596730 AAAGGAAACATAGGTCTGACAGG + Intergenic
1031317698 7:120276207-120276229 ATAGGAATTATGGTTCTTAGAGG - Intronic
1032791207 7:135243921-135243943 AAAGGAACCATGGTACACCCAGG + Intronic
1032796634 7:135282632-135282654 TAAGGAATCGTAGTTCTCAGCGG + Intergenic
1035052832 7:156012332-156012354 GAAGAAAGCATTGTTCTCACAGG - Intergenic
1035894493 8:3382941-3382963 AAAGAAAACATGATGCTCACAGG + Intronic
1036285162 8:7438026-7438048 AAAGGAATCATGGATTTCTGAGG + Intergenic
1036336314 8:7873503-7873525 AAAGGAATCATGGATTTCTGAGG - Intergenic
1037089090 8:14891000-14891022 AAAGGAATCTTGTTTTTCTCAGG - Intronic
1039409306 8:37339194-37339216 ACAGGAATCATGGTTCTCATGGG + Intergenic
1039540070 8:38359418-38359440 AAAGGACTCATGGCTTTCAAAGG - Intronic
1039923879 8:41911756-41911778 AAAGGAAACTAGGCTCTCACTGG - Intergenic
1040644191 8:49379246-49379268 AAAGGAACCAGAGTTCTAACTGG + Intergenic
1041148542 8:54906702-54906724 GAAGGAGGCATGGTTATCACAGG + Intergenic
1041160275 8:55034775-55034797 AAAGAATTCATGCTTCTCAGGGG + Intergenic
1041441064 8:57897573-57897595 AAAGGAATCATGGTAGGCATGGG - Intergenic
1042319441 8:67459581-67459603 AAAGGATTCATGGTTGTCATGGG + Intronic
1042941530 8:74113576-74113598 AAAGGAAGCATGCTTCTACCAGG - Intergenic
1044786610 8:95800588-95800610 AAAGGCATCATGGTCCTAAAGGG + Intergenic
1045190075 8:99873142-99873164 TAAGGAATCATGATGGTCACAGG - Intronic
1045876136 8:106983021-106983043 AAAAGTTTCATGGTTGTCACTGG - Intergenic
1045983871 8:108224701-108224723 ACAGGCATGATGGTTCTTACTGG + Intronic
1046167287 8:110453036-110453058 AGAAGAATAATGTTTCTCACAGG + Intergenic
1048332845 8:133482783-133482805 AAAGGAGTCATTCTTCTTACTGG - Intronic
1049695263 8:143981118-143981140 AAAGTCATCAAGGTGCTCACCGG + Intronic
1051444633 9:17127175-17127197 AAAGGAATGATGGTTACCCCTGG - Intergenic
1052687515 9:31774058-31774080 AAAGGAATCATGGTTCATACTGG + Intergenic
1053133212 9:35631425-35631447 AAAGCAAATATGGTTCTCAATGG - Intronic
1056405877 9:86274611-86274633 GAAGGAATCAAGTATCTCACTGG + Intronic
1057167424 9:92940097-92940119 ATAGAAATCAGGGTTCTCAGGGG - Intergenic
1058188460 9:101884270-101884292 AAGTGATTCATGATTCTCACAGG - Intergenic
1059198920 9:112396617-112396639 AAAGGAATCACGGTTCATACTGG - Intronic
1185579916 X:1203858-1203880 AAAGAGTTCATAGTTCTCACCGG + Intronic
1189158019 X:38779823-38779845 AAAAGAATCATGGTTACCAGGGG - Intergenic
1190432036 X:50387469-50387491 AAAGCAAACATGCCTCTCACTGG - Intronic
1193005316 X:76611572-76611594 AAAAGAAGCATGGTTGTTACTGG + Intergenic
1194615721 X:96101079-96101101 AAAGGAAACATTGTTATCATAGG + Intergenic
1195161857 X:102179358-102179380 AAAGGAATTAATGTGCTCACTGG - Intergenic
1195287176 X:103396574-103396596 AAAGGAAACACAGTTCTCTCAGG - Intergenic
1202068854 Y:20969371-20969393 AAAGGAATTAATGTGCTCACTGG + Intergenic