ID: 1166992950

View in Genome Browser
Species Human (GRCh38)
Location 19:46704246-46704268
Sequence CTGTGGATGAGGAAGGTGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166992945_1166992950 3 Left 1166992945 19:46704220-46704242 CCTGGCAAACGGTGGGCCGTGTA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG 0: 1
1: 0
2: 5
3: 44
4: 511
1166992939_1166992950 25 Left 1166992939 19:46704198-46704220 CCCTTGAGGAGTTTCTTGCAAGC 0: 1
1: 0
2: 0
3: 21
4: 878
Right 1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG 0: 1
1: 0
2: 5
3: 44
4: 511
1166992940_1166992950 24 Left 1166992940 19:46704199-46704221 CCTTGAGGAGTTTCTTGCAAGCC 0: 1
1: 0
2: 0
3: 14
4: 118
Right 1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG 0: 1
1: 0
2: 5
3: 44
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166992950 Original CRISPR CTGTGGATGAGGAAGGTGTG CGG Exonic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900857705 1:5199287-5199309 TTGGGGATGAGGAAGATGGGTGG - Intergenic
901032150 1:6313440-6313462 TTGTGGCTGAGCAGGGTGTGGGG - Intronic
901243419 1:7709013-7709035 GTGTGGCTGAGGATGGGGTGTGG - Intronic
901811494 1:11769185-11769207 GTGGGGATGAGGAAGTAGTGGGG - Intronic
901823934 1:11848272-11848294 TGGCGGATGAGGCAGGTGTGAGG - Intronic
901902163 1:12374506-12374528 CAGTTGATTAAGAAGGTGTGTGG + Intronic
902534230 1:17110008-17110030 CTGGGGAATAGGAGGGTGTGGGG - Intronic
902674445 1:17999084-17999106 CTGTGGGTGAGCACAGTGTGGGG + Intergenic
902802957 1:18841734-18841756 GTGTGGTTGAGGAAGGTGCCGGG + Exonic
902838365 1:19060510-19060532 CTGTGGTGGAGTAGGGTGTGGGG - Intergenic
902924439 1:19686789-19686811 CTGTGGTTCAGGAAATTGTGAGG - Intronic
903188484 1:21642792-21642814 ATGTGGAGGAGAAAAGTGTGTGG - Intronic
903630139 1:24762448-24762470 GTGTGGATGAGTAAAGAGTGAGG + Intronic
903867415 1:26409771-26409793 CAGTGGATGGGGATGGGGTGGGG + Intergenic
903884486 1:26532864-26532886 CTGAGGAAGAGGGAGGAGTGTGG + Intronic
904565803 1:31427678-31427700 GTGAGGATGAGGATGGTGTGAGG - Intronic
904599862 1:31667407-31667429 CTGTGGAGGTGGAGGCTGTGAGG - Intronic
905347130 1:37318775-37318797 CTGTGCTTCAGGAGGGTGTGGGG + Intergenic
905633008 1:39529418-39529440 CTGAGGAAGTGGCAGGTGTGCGG + Intergenic
905883841 1:41481271-41481293 GTGGGGATGGGGAAGGGGTGGGG - Intronic
906611128 1:47204237-47204259 CAGAGGCTGAGAAAGGTGTGTGG + Intergenic
906680445 1:47722611-47722633 CTGTGGAAGAGGAAGATTTCAGG + Intergenic
907408707 1:54269934-54269956 CTGTGGACGATGATTGTGTGGGG + Intronic
907732349 1:57079448-57079470 AAGTGGATGAGGAAGGACTGAGG - Intronic
907774290 1:57498308-57498330 CTGTAGATGTGGAAAGTCTGAGG + Intronic
908317025 1:62942721-62942743 TTGGGGGTGAGGAAGGGGTGTGG + Intergenic
908931143 1:69316752-69316774 TTGTGGAGGAGGCAGGTGTCCGG + Intergenic
909585117 1:77281288-77281310 CAGTGGAGGAGAAAGGTGGGTGG - Intergenic
911518403 1:98897666-98897688 CTGTTGCTGCGGAAGCTGTGTGG + Intronic
911620144 1:100057389-100057411 CTGTTGCTGAGGATGGAGTGTGG + Intronic
911693289 1:100859958-100859980 TGGTGGATGAGGAAGGGATGAGG - Intergenic
912055473 1:105592912-105592934 CTGTGGATGGAGCAGGTTTGGGG - Intergenic
912415685 1:109507130-109507152 ATGGGAATGAGGAAGGAGTGAGG - Exonic
914265203 1:146032636-146032658 AAGTGGATGAGGAAGGAGTGTGG - Intergenic
914750829 1:150533991-150534013 CTGTGGACAAGGATGGCGTGGGG + Intergenic
915282218 1:154830310-154830332 CCCTGGATGAGGAAGAGGTGGGG + Intronic
915545105 1:156592495-156592517 CTGTGGGGGAGGAGGGCGTGAGG + Intronic
915652722 1:157330039-157330061 CTGTGGATGACAAAGGTTTTAGG - Intergenic
915910926 1:159914851-159914873 CTGTGGTCGGGGAAGGGGTGTGG + Intergenic
917513156 1:175684903-175684925 CTGAGGAAGAGGAGTGTGTGGGG - Intronic
917517382 1:175719318-175719340 GTGTGGATGGGGGAGGGGTGAGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917954741 1:180083223-180083245 GTGTGATTGAGGGAGGTGTGAGG + Intronic
918108722 1:181436710-181436732 GGGTGGATGAGAAAGGGGTGAGG + Intronic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
919012733 1:191986287-191986309 TTGTGGCTGGGGAAGGGGTGGGG - Intergenic
920003596 1:202816085-202816107 ATGTGGATGAGGAACCTGGGTGG + Intergenic
920232710 1:204481145-204481167 GTGTGTATGGGGAGGGTGTGAGG - Intronic
920508680 1:206534917-206534939 GTTTGGATGAGGAAGGAGGGAGG - Intronic
921116912 1:212100508-212100530 GTGGTGATGAGGAAGGTGTTCGG - Exonic
921159600 1:212463696-212463718 CTGGGGAGGAAGGAGGTGTGAGG + Intergenic
922421015 1:225461299-225461321 CCGTGGATGAGGATGAAGTGGGG - Intergenic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
1063368177 10:5504070-5504092 GTGTAGGGGAGGAAGGTGTGTGG - Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1063944331 10:11162329-11162351 CTTTTGATCAGGAAGGTGGGGGG + Intronic
1067068006 10:43114457-43114479 CTGTGGGTGGGGGTGGTGTGAGG - Intronic
1067543572 10:47175660-47175682 CAGTGCATGTGGAAGGTGTTTGG - Intergenic
1068916111 10:62433459-62433481 CTGTGCATGAGCAATTTGTGTGG - Intronic
1069242100 10:66155543-66155565 CTGTAGATCAGGAACGTGTGTGG - Intronic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1070105230 10:73425277-73425299 CTGGGGATAAGCAAGGTGAGGGG - Intronic
1070279085 10:75035838-75035860 GAGAGCATGAGGAAGGTGTGGGG + Intergenic
1070951902 10:80437725-80437747 CCCTGGATTAGGGAGGTGTGGGG + Intergenic
1070983092 10:80665965-80665987 ATATGGAAGAGGAAGGAGTGAGG - Intergenic
1071396933 10:85233296-85233318 CTGTGGATGGGGGTGGTGAGCGG + Intergenic
1071465280 10:85934131-85934153 CTGTGGATGGGCAAGCTGTCTGG + Intronic
1072935453 10:99708160-99708182 CTTAGGATGAGGAGGGGGTGGGG - Intronic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073585994 10:104710667-104710689 CTCTGGATGAGGTGGGGGTGGGG - Intronic
1074052262 10:109890775-109890797 GTGTGTATGTGGAGGGTGTGTGG + Intronic
1074644980 10:115439194-115439216 CTGAGGATGAGGAAGAGGAGGGG + Intronic
1074807718 10:117070440-117070462 CTGGGAATAAGGAAGGTGAGGGG - Intronic
1075007105 10:118839107-118839129 CTGGGGAGGAGGAAGGGATGGGG + Intergenic
1075439530 10:122468504-122468526 CTGGGGATGAGGTGGGTGGGTGG + Intronic
1075481419 10:122785768-122785790 CTTTGGCTAAGGAATGTGTGGGG - Intergenic
1075580485 10:123614123-123614145 CTGGGGTTGAGGAAGATTTGAGG + Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1076029364 10:127144299-127144321 GTGTGGATGAGGCAGGGGGGAGG - Intronic
1076777006 10:132703446-132703468 CTGTGGGTGAAGCATGTGTGTGG - Intronic
1076785339 10:132746934-132746956 CTGTGAATGAGGCAGCTCTGGGG + Intronic
1076832302 10:133001984-133002006 CTGGGGCTGAGGAAGCTGAGAGG + Intergenic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1080204978 11:29717834-29717856 ATGTGGATGAGGAACTTGTTGGG - Intergenic
1080795658 11:35560545-35560567 CTGTGGATGGAGTAGGTCTGGGG + Intergenic
1081395385 11:42580434-42580456 CTGTGCATGAGCAAGATTTGGGG - Intergenic
1081597047 11:44466625-44466647 ATGTGGCTGGTGAAGGTGTGAGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083050167 11:59769864-59769886 GTGTGGGGGGGGAAGGTGTGTGG + Intronic
1083234179 11:61341446-61341468 CTCTGGCTGAGGCTGGTGTGGGG + Exonic
1083589925 11:63887798-63887820 CTTAGCAGGAGGAAGGTGTGAGG + Intronic
1084650935 11:70488808-70488830 ATGTGGATGTTGAATGTGTGGGG + Intronic
1085054765 11:73397162-73397184 TTGGGGGTGAGGAAGATGTGCGG + Exonic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085393467 11:76194417-76194439 CTGAGGATGAGGATGGTGCGAGG + Intronic
1085844448 11:80049493-80049515 GTGTGGATGAGGATAGAGTGGGG - Intergenic
1087562489 11:99808220-99808242 CTATGGATGAGGCAAATGTGTGG + Intronic
1088573821 11:111250283-111250305 CTGGGGATGAGGAAACTGAGAGG - Intergenic
1088641098 11:111873602-111873624 GTGTGGGTGAGAGAGGTGTGGGG - Intergenic
1088767613 11:112999045-112999067 CTCTGAAGGAGGTAGGTGTGTGG - Intronic
1088842977 11:113642177-113642199 CCCTGGGTGGGGAAGGTGTGGGG - Intergenic
1089620032 11:119716910-119716932 GTGTGTATGAGGAAGGTTTATGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090193253 11:124791764-124791786 CTGGGGAGGAGGAGGATGTGGGG + Intronic
1090331903 11:125939216-125939238 CTGAGGAGCAGGAAGGAGTGGGG - Intergenic
1091039887 11:132267406-132267428 CTATGGGTAAGGAAAGTGTGAGG - Intronic
1091253027 11:134159880-134159902 CTGTGGCACAGGTAGGTGTGGGG - Exonic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091636284 12:2199333-2199355 CTGAGGAGGAGGAAGGGGAGGGG - Intronic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091793831 12:3286262-3286284 GTGGGGAGGAGGAAAGTGTGGGG - Exonic
1091823569 12:3493204-3493226 CTGGGGAAGAGGAAGTGGTGAGG - Intronic
1092280299 12:7092930-7092952 CTGGGGCAGAGGAGGGTGTGTGG + Intronic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092705806 12:11282923-11282945 CTTTGGAAGAGTGAGGTGTGAGG - Intergenic
1095722753 12:45418368-45418390 CAGTAGATGTTGAAGGTGTGGGG - Intronic
1095858205 12:46885299-46885321 CTGGAGATGAGTAAGGAGTGAGG - Intergenic
1096463600 12:51836360-51836382 ATGAGGATGAGGATGGTGGGCGG - Intergenic
1096841655 12:54383549-54383571 CAGTGTTTGAGGAAGGTGAGTGG - Intronic
1096884896 12:54707672-54707694 CTTTGGATGATGAAGGAGTTTGG - Intergenic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097059162 12:56269596-56269618 CTGGGTATGAGGAAGGGCTGGGG + Intronic
1097243564 12:57592403-57592425 CTGTGGAGATGGAAGTTGTGAGG + Intronic
1098122178 12:67253452-67253474 CTGGGGATGAGGATGGAGAGAGG - Intergenic
1098244319 12:68500642-68500664 GTGTGGATGAGGGAGGTCGGCGG + Intergenic
1100698930 12:97125332-97125354 CTGTGGAGGAGGAGGATGTAAGG + Intergenic
1102654120 12:114466002-114466024 CTGATGAAGAGCAAGGTGTGTGG - Intergenic
1102662739 12:114544043-114544065 CTTTGGAAGACGGAGGTGTGTGG + Intergenic
1102676636 12:114664026-114664048 ATGTGGAGGTGGAAGGTGTAGGG + Intergenic
1103088096 12:118077497-118077519 CTGTGAAAGAGGAATGTTTGTGG + Intronic
1104648476 12:130514004-130514026 CTGGGGAGGCTGAAGGTGTGGGG - Intronic
1104897995 12:132173628-132173650 GTGTGGACCAGGCAGGTGTGCGG + Intergenic
1105592864 13:21810733-21810755 CTGTGGCTGAGAAAGGGGAGAGG + Intergenic
1105627548 13:22127470-22127492 GTGTGTATGAGTAATGTGTGTGG - Intergenic
1107142898 13:37022247-37022269 CTGAGCATCAGGAGGGTGTGGGG + Exonic
1107502574 13:40995358-40995380 CTCATGATGTGGAAGGTGTGAGG + Intronic
1108513670 13:51177433-51177455 TTGGGAATGTGGAAGGTGTGGGG - Intergenic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1108712798 13:53050395-53050417 CTGTGGATGAGAATGGATTGTGG + Exonic
1112114325 13:96335606-96335628 TTCTGGATGAGGAATCTGTGAGG + Intronic
1112609945 13:100946227-100946249 CTCTGGAAGAGGATGCTGTGGGG - Intergenic
1113078930 13:106496233-106496255 CAGTGGAGGAAGCAGGTGTGGGG - Intronic
1113357169 13:109591850-109591872 CTGGGGATAAGGAAGGTGTAGGG + Intergenic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1114844938 14:26309458-26309480 CTGGGGAAGAGGCAGCTGTGGGG + Intergenic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1116011076 14:39353027-39353049 CAGTGGAAGAGGATGGGGTGGGG - Intronic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117596638 14:57332565-57332587 CTGTGTGTGTGCAAGGTGTGGGG + Intergenic
1117918680 14:60705196-60705218 CTGTGGATAAGATAGGTGTGGGG + Intergenic
1117978215 14:61319151-61319173 CTGGAGCTGAGGAAGGTGAGGGG - Intronic
1118764144 14:68898920-68898942 CTGTGGGTGTGGCATGTGTGAGG - Intronic
1118951990 14:70443295-70443317 CTCTGGGTGGGGAAGGTGTTGGG + Intergenic
1119704346 14:76774615-76774637 CTGTGCCTGAGGGAGCTGTGGGG - Intronic
1119742582 14:77023893-77023915 CTGAGGATGAGGAAGAGGGGGGG - Intergenic
1120551415 14:85877444-85877466 CTATGGGTGCTGAAGGTGTGAGG - Intergenic
1121587453 14:95072047-95072069 CTGCGGATGAGGATGGGGAGCGG - Intergenic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122408200 14:101512683-101512705 CTGGGCATCGGGAAGGTGTGTGG - Intergenic
1122827233 14:104376234-104376256 CAGAGGATGTGGTAGGTGTGAGG - Intergenic
1122850044 14:104523118-104523140 CTGTGGCTGTGGGTGGTGTGGGG + Intronic
1122899557 14:104776716-104776738 CAGCGGATGATGAAGGTGTTGGG + Exonic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1123020405 14:105395339-105395361 CTGAGAGTGGGGAAGGTGTGAGG - Exonic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1123816615 15:23986237-23986259 CTGTGGATGACAAAGGTTTCAGG + Intergenic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1128194932 15:65744271-65744293 CTGTGGATAAAGCAGGTTTGGGG + Intronic
1129638620 15:77350679-77350701 CTATGGCTGAGGAAGCTGTAGGG - Intronic
1130072898 15:80664029-80664051 CTGGGGATCAGGGAGATGTGTGG + Intergenic
1130298971 15:82665985-82666007 CTGTGAGTGAGGATGGTGTCGGG + Intronic
1130857486 15:87853795-87853817 CAGTGGATGAGGAGGATGTTGGG + Intergenic
1131332450 15:91514463-91514485 CTGTGGATGAGGCCGCTGAGTGG + Intergenic
1131593536 15:93773808-93773830 CTGAGGATAAGGAAAGTGTAGGG - Intergenic
1132204256 15:99975738-99975760 CTGTGCATGAGGAATGTGAAGGG - Intronic
1132307128 15:100824450-100824472 GAGTGGATGAGGAAGGTGAGTGG - Intergenic
1132393332 15:101454607-101454629 CTGTGGGGGAGGGAGGAGTGGGG + Intronic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1132618611 16:854187-854209 CTGTAGTGGAGGAAGGTGTCAGG + Exonic
1132742168 16:1420316-1420338 CAGTGGTTGAGACAGGTGTGGGG - Exonic
1132762729 16:1518799-1518821 CTGTGGCAGAGCAGGGTGTGTGG + Intronic
1132989890 16:2787142-2787164 GTGAGGATGAGGGAGGGGTGAGG - Intronic
1133445207 16:5853684-5853706 CTGTAGACGAGGGAGGTGTGGGG + Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133887721 16:9846198-9846220 CTGGAGATGAGGAAGAGGTGGGG - Intronic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1134360043 16:13522801-13522823 ATGGGGATGAGGCAGGTGTCTGG - Intergenic
1134803597 16:17106919-17106941 CTGAGGATGAGGAGGATGGGGGG + Exonic
1135665267 16:24330357-24330379 TTGGGGATGTGGAAGGTTTGTGG - Intronic
1136381466 16:29898020-29898042 CTCTGGAGAAGGAAGGGGTGTGG - Intronic
1136991047 16:35151612-35151634 AAGTGGACAAGGAAGGTGTGTGG - Intergenic
1137250832 16:46739542-46739564 AGGAGGATGAGGAAGGTGAGGGG - Intronic
1137894769 16:52199502-52199524 ATTTGGAGGAGGAAGGTTTGGGG - Intergenic
1138190450 16:55009748-55009770 ATGTGGATTGGGAAGGTCTGGGG + Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1139252008 16:65505581-65505603 CTGGGGATAAAGAGGGTGTGAGG + Intergenic
1140468826 16:75203676-75203698 CAGTGGATGCAGAAGGTGTGAGG + Intergenic
1140469635 16:75206851-75206873 CTGGGGGTGAGGAAGGGGAGCGG + Intronic
1141167240 16:81668896-81668918 AGGTGGGTGTGGAAGGTGTGAGG - Intronic
1141167251 16:81668943-81668965 AGGTGGGTGTGGAAGGTGTGAGG - Intronic
1141167409 16:81669645-81669667 AGGTGGGTGTGGAAGGTGTGAGG - Intronic
1141188867 16:81809021-81809043 CTAGGGGTGAGGAAGGAGTGTGG + Intronic
1141443187 16:84042442-84042464 ATGGGGATGAGGAAGGTTGGGGG - Intronic
1141538411 16:84699767-84699789 CTGTGGATCCGGAAGGGGAGAGG - Intergenic
1141651709 16:85396432-85396454 CTGGGGAGGTGGAAGGGGTGTGG - Intergenic
1141698745 16:85632823-85632845 CTGTGGGTGATGTAGGGGTGGGG + Intronic
1142186779 16:88698453-88698475 GGGTGGATGAGGAGGGCGTGGGG + Intronic
1142248976 16:88982569-88982591 CTGTGGGGGAGGAGGCTGTGGGG - Intergenic
1142858245 17:2745281-2745303 ATCTGGAGGATGAAGGTGTGTGG + Intergenic
1143022268 17:3922990-3923012 CTGGGGAGGTGGTAGGTGTGAGG + Intergenic
1143102434 17:4511870-4511892 CTGGGGGTGTGGAAGGAGTGGGG - Intronic
1143891328 17:10104719-10104741 AATTGGATGTGGAAGGTGTGTGG - Intronic
1145747268 17:27329497-27329519 CTGGGGATGAGGAACAGGTGAGG + Intergenic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146884013 17:36459013-36459035 CTGAGGCTGAGGAAGGTGAAGGG + Intergenic
1147006409 17:37407139-37407161 CTGTGGGGGAGGGCGGTGTGGGG + Intronic
1147605914 17:41773626-41773648 CTGTTGCTGGGGAAGGGGTGTGG - Intronic
1147650671 17:42060066-42060088 CTGTGGCTGAGGATGTTGTCTGG - Intronic
1147667921 17:42160301-42160323 CTGTGGACAAGGAGGGTCTGGGG + Exonic
1147710918 17:42463992-42464014 CTGAGGAGGAGGAAGGGGAGGGG + Intronic
1148603002 17:48908382-48908404 CTGTGGAAGCGGAGGGGGTGGGG + Exonic
1150122708 17:62617219-62617241 CACTGGATGAGGGAGGGGTGAGG + Intergenic
1150125669 17:62632913-62632935 CTGTAGATGAGGCAGGAGTGTGG + Intronic
1150255694 17:63742332-63742354 CTGTGGATGAGGAAGGCTTCGGG - Intronic
1151026696 17:70685537-70685559 CTGAGGTTGAGGGAGCTGTGTGG + Intergenic
1151175207 17:72282433-72282455 CTGGGGATGTGGAGGGTGTGCGG - Intergenic
1151390039 17:73780607-73780629 TGGGGGATGAGGAGGGTGTGAGG - Intergenic
1151408474 17:73904604-73904626 ATGTGGATAAGGAAGGCATGAGG - Intergenic
1151575773 17:74951971-74951993 TTGCGGATGAGGATGGGGTGGGG + Exonic
1151850718 17:76688105-76688127 CTGAGGAGGAGGACGGTGAGTGG - Exonic
1151954803 17:77374827-77374849 CTGGGCCTGAGGAGGGTGTGGGG + Intronic
1152534729 17:80943871-80943893 CTCTGGCTGAGGAAGGCTTGGGG + Intronic
1152538957 17:80965299-80965321 CTGTATGTGAGGAACGTGTGGGG - Exonic
1152659499 17:81535749-81535771 ATGGGGATGAGGATGGTGAGGGG - Intronic
1152659508 17:81535773-81535795 ATGGGGATGAGGATGGTGAGGGG - Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1152932249 17:83115872-83115894 ATGTGCTGGAGGAAGGTGTGGGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1155164402 18:23220879-23220901 CTTTAGAATAGGAAGGTGTGTGG + Intronic
1156061001 18:33076175-33076197 CTGTGTGTGAGCAAGGCGTGGGG - Intronic
1156961297 18:43034901-43034923 CAGAGGAGGAGGAAGGTGAGAGG - Intronic
1157213060 18:45760245-45760267 CTGTCCATGAGGAATGTGTAGGG - Intergenic
1157539322 18:48488472-48488494 CTGTGGATGACGTTTGTGTGAGG - Intergenic
1160106872 18:75986645-75986667 TGGTGGATGAGGAAGGCGTGTGG + Intergenic
1160512062 18:79458263-79458285 CTGGGCATGAGGATGCTGTGGGG + Intronic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1161044801 19:2129090-2129112 CTGTGGATGAGATTGGTGAGGGG + Exonic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1162158533 19:8696032-8696054 CTGTGGAGGAGGGAGTTGGGAGG + Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1165865361 19:38933609-38933631 ATGTTGATGTGGAAGGGGTGTGG + Intronic
1166058805 19:40311600-40311622 CTGTGAAAGCGCAAGGTGTGGGG - Intergenic
1166259492 19:41627631-41627653 CTGTGGTGGAGGGAGGTGGGTGG + Intronic
1166266694 19:41688775-41688797 CTGTGGTGGAGGGAGGTGTGTGG + Intronic
1166499929 19:43332843-43332865 CTGTGGTGGAGGGAGGTGGGTGG + Intergenic
1166701078 19:44882043-44882065 CTGAGCATGAGGAAGGAGCGAGG - Intronic
1166961375 19:46497998-46498020 CTGTGGATCAGGAAGATCAGAGG - Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168188783 19:54722721-54722743 TTGTGGATTAGGAAGATTTGAGG - Intergenic
926106958 2:10158599-10158621 CTTTGGGTAAGGAAGGTGAGGGG - Intronic
926200173 2:10789821-10789843 CTGTGGATTATGACGGTGGGCGG - Exonic
927887779 2:26729035-26729057 CTGGGGATGAGGAAGGGGAGTGG - Exonic
928126366 2:28619397-28619419 ATGTGGGTGAGGAGGGAGTGTGG + Intronic
928618324 2:33061837-33061859 CTGTGTATAAGGTAGGTATGTGG + Intronic
929950428 2:46405843-46405865 GTGATGATGAGGCAGGTGTGGGG - Intergenic
930237749 2:48904100-48904122 CTGTGGATATGGCAGGTATGTGG - Intergenic
930844055 2:55882012-55882034 CAAGGGATGAGGATGGTGTGAGG - Intronic
931514358 2:63036407-63036429 CTGTGGAGAAGGGAAGTGTGGGG + Intronic
931665464 2:64607160-64607182 CTGTGGGTGTGGAAGCTGTGAGG + Intergenic
931841370 2:66153170-66153192 CTGTGTATGTGGATGGTGTTGGG + Intergenic
932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG + Intronic
932312783 2:70757270-70757292 CTGTGGATAAGGGATTTGTGGGG + Intronic
932435169 2:71699173-71699195 CTTTGAATGAGGGAGGTGAGAGG - Intergenic
932574469 2:72955115-72955137 CTGTGGATGAGTGAGGTACGGGG - Intronic
933166891 2:79086530-79086552 CAGTGGAGAAGGAAGGTGTGAGG + Intronic
934551743 2:95267093-95267115 CGGTGGACGTGGAAGGTGGGGGG + Intergenic
934897439 2:98131109-98131131 CAGTGGCTGGGAAAGGTGTGAGG - Intronic
935081453 2:99800912-99800934 CTGGGGATGAGTGGGGTGTGTGG + Intronic
935220072 2:101004597-101004619 CAGTGGAGGAGGGAGGGGTGAGG + Intronic
937301225 2:120843639-120843661 CTCTGGATCAGGGAGGAGTGTGG + Intronic
937968995 2:127535594-127535616 CTGGGGCTGAGGGAGGCGTGTGG + Intergenic
937972968 2:127564544-127564566 AGGTGGGTGAGGAAGGTGTGTGG + Intronic
938338291 2:130518386-130518408 CTCTAGATGAGGAAAATGTGTGG + Intergenic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
939082669 2:137681665-137681687 CTGTGGATCAAGAAAGTTTGGGG - Intergenic
939145772 2:138412904-138412926 TTGTGGATGAGAGAGCTGTGCGG - Intergenic
939183273 2:138828654-138828676 TTGTGGATGAGGAAGTTACGAGG - Intergenic
940031057 2:149261718-149261740 CAGTGCATGAGGCAGGTGTCAGG - Intergenic
940192732 2:151059609-151059631 CTGTGGGTGAGGCAGATGTCTGG - Intergenic
940721837 2:157290989-157291011 CTGTGAATGAGGAGGTTGAGAGG + Intronic
941160125 2:162026224-162026246 ATGGGGATGATGAAGCTGTGAGG - Intronic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
943862947 2:192892146-192892168 TTGGGGAGCAGGAAGGTGTGGGG + Intergenic
944389284 2:199200724-199200746 ATGTGGAGGAGGAAGCTGTTGGG - Intergenic
944970052 2:204982378-204982400 CTGTGGATCAGGCATGGGTGTGG + Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946487038 2:220110716-220110738 CAGTGGATGTGGCAGTTGTGTGG - Intergenic
946716173 2:222556786-222556808 GGGTGGATGGGGAAGGAGTGAGG - Intronic
946716194 2:222556847-222556869 GGGTGGATGGGGAAGGAGTGAGG - Intronic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947536353 2:230942493-230942515 AGGTGGAAGAGGCAGGTGTGGGG + Intronic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948831527 2:240600715-240600737 CAGTGGATGAGGGAGATCTGTGG - Intronic
1169661584 20:7984260-7984282 CTGTGGGTGGGGAAGGATTGAGG + Intronic
1170723670 20:18906164-18906186 CTGTGGATGCAGAGGGTGAGAGG + Intergenic
1170794207 20:19532348-19532370 TTGTGGATGAGGGAGCAGTGAGG - Intronic
1170878401 20:20272595-20272617 CTGTGCCTGAGGGAGGTGTTGGG - Intronic
1170909980 20:20556835-20556857 CTGGGGATGAGGGAGGGCTGGGG + Intronic
1171135886 20:22694100-22694122 AGGTGGATGAGGTAAGTGTGGGG - Intergenic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171249524 20:23637713-23637735 GCGTGGAGGAGGAGGGTGTGCGG - Exonic
1172656689 20:36542148-36542170 CTGTGGGTGGGGAAGGTCTGCGG + Intronic
1172740307 20:37161378-37161400 CTGTGGATGAGGCAACTGAGAGG + Intronic
1172947905 20:38702869-38702891 CAGTGGGTGATGAAGGTGTCAGG - Intergenic
1173264804 20:41469396-41469418 CAATGGAAGAGGAAGGTTTGTGG + Intronic
1173461409 20:43246262-43246284 CTCAGGATGAGGGAGGTGAGAGG + Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173790430 20:45824487-45824509 AGGTGGATGAGGACGGTGAGCGG - Exonic
1174180629 20:48672188-48672210 CTATGAAAGAGGCAGGTGTGCGG - Intronic
1174285590 20:49470618-49470640 CTCTGGATGAAGAATGTGTCTGG - Intronic
1174414858 20:50359950-50359972 GTGTAGATGTGGAAGGTGAGAGG + Intergenic
1174602482 20:51736007-51736029 GAGTGAATGAGGAAGGGGTGTGG + Intronic
1175082091 20:56429213-56429235 CCATGGATGATGAAAGTGTGCGG + Intronic
1175950432 20:62580691-62580713 CTGTGGAGCAGGGAGGTGGGAGG + Intergenic
1175959182 20:62626419-62626441 CAGTGGATGAGGCAAGAGTGTGG - Intergenic
1176050975 20:63119654-63119676 CTGTGGAGGAGGAGGCTTTGTGG - Intergenic
1176120024 20:63450172-63450194 CTTTGGGTGAGGGAGGGGTGGGG - Intronic
1176157143 20:63627477-63627499 CTGTGGAGGAGGACGCTGTAGGG + Intergenic
1176283522 20:64328524-64328546 CTGGAGGAGAGGAAGGTGTGGGG + Intergenic
1176303180 21:5108583-5108605 ATGTGGCTGGGGAAGGGGTGTGG - Intergenic
1176424239 21:6538173-6538195 CTGTGGGTGAGGCAGGAGTGTGG + Intergenic
1177197421 21:17918087-17918109 CTGAGGATAAGGAAGGTGTTAGG + Intronic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1179699732 21:43146488-43146510 CTGTGGGTGAGGCAGGAGTGTGG + Intergenic
1179853845 21:44153341-44153363 ATGTGGCTGGGGAAGGGGTGTGG + Intergenic
1181027971 22:20136457-20136479 CTGTGGATAGGGCAAGTGTGAGG - Intronic
1181308509 22:21930809-21930831 CTGTGGGTGAGGAAGGCCTCAGG - Intronic
1182030410 22:27155015-27155037 TGGTGGAGGAGGAAGTTGTGAGG - Intergenic
1182299765 22:29330953-29330975 CCGAGGAGGAGGAAGGCGTGTGG - Intronic
1182371955 22:29817433-29817455 CTGAGGTTGAGAATGGTGTGAGG - Intronic
1182415173 22:30216798-30216820 GTGTGAAGGAGGAGGGTGTGAGG + Intergenic
1182462413 22:30491974-30491996 CTGTGGGTGAAGGGGGTGTGTGG + Intronic
1182467379 22:30525751-30525773 CTGTGGGTGAAGGGGGTGTGTGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183018904 22:35011581-35011603 CTGTGGTTGAGAGAGGTGAGAGG - Intergenic
1183598284 22:38825215-38825237 CTGGGCATGAGGAAGATGGGTGG + Intronic
1183739401 22:39661780-39661802 CTGTGGATGTGGATGGAGTGAGG + Intronic
1184098459 22:42329248-42329270 CTGGGGATGAGGATGGTTTATGG - Intronic
1184973485 22:48044557-48044579 CTGAGGCTGAGGCTGGTGTGGGG - Intergenic
1185046193 22:48529772-48529794 GTGTGGACGGGGAGGGTGTGTGG + Intronic
1185184535 22:49390586-49390608 GTGGGGAGGAGGAAGGTGAGAGG - Intergenic
1185339454 22:50284993-50285015 CAGTGGAGGAGGCAGGCGTGTGG - Intronic
949997083 3:9626604-9626626 CAGAGGCTGAGGAAGGAGTGAGG - Intergenic
950520115 3:13493160-13493182 CTGTGGGTGGGGCAGGTGGGGGG - Intronic
950756025 3:15173392-15173414 CAGTGTAAGAGGAAGGTCTGGGG - Intergenic
950887782 3:16375923-16375945 TTCTGGGTGAGGAAGGTGAGTGG + Intronic
952561323 3:34596854-34596876 GTGTGTATGAGGAGGGTATGGGG + Intergenic
952914930 3:38228978-38229000 CTCAGGATCAGGTAGGTGTGTGG + Intronic
953134884 3:40173844-40173866 CTGTGCAGGAGGCAGGTGTTTGG - Intronic
953361702 3:42302817-42302839 CTGGGGACCAGGGAGGTGTGAGG + Intergenic
953891445 3:46754422-46754444 CTGGGAATGAGGAAGCTTTGAGG + Intronic
953896929 3:46810090-46810112 TTGGGGATGAGGAAGCTTTGAGG + Intronic
954412707 3:50377978-50378000 CTCTGGACAAGGAAGGGGTGGGG - Intronic
956128907 3:66037048-66037070 GTATGGAGGAGGAAGGAGTGGGG - Intronic
956958116 3:74365008-74365030 CTGTGGATTAGAAAGGTTTCTGG + Intronic
961352424 3:126312416-126312438 CTTTGGATGACCAAGGTGGGAGG - Intergenic
961569202 3:127786058-127786080 ATGTGGAGGAGGAAGGTGAGAGG + Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
963119581 3:141764804-141764826 CTCTGGAGGAGCAGGGTGTGGGG - Intergenic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
963709291 3:148728008-148728030 ATGTGGGAGAGGGAGGTGTGGGG - Intronic
964350625 3:155799926-155799948 CTGGGGATGAGCAAGAAGTGGGG + Intronic
965403054 3:168236525-168236547 ATGTGAATGAGGAAGCTCTGGGG - Intergenic
966078037 3:175963013-175963035 GTGTGGATGGAGAAGATGTGAGG + Intergenic
967179333 3:186889726-186889748 TTGAGGTTGAGGAAGATGTGAGG + Intergenic
968036216 3:195550198-195550220 CCGTGGCTGAGGCAGGTGGGGGG + Intergenic
968472918 4:790125-790147 CTGTGGAGGAGGACTCTGTGGGG + Intronic
968529986 4:1086608-1086630 GTGGGGGTGAGGAAGGGGTGGGG + Intronic
968812205 4:2805156-2805178 CTCTAGATGAGGAAGGTGCCCGG + Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
969196386 4:5566853-5566875 CTCTGGAGTAGGAACGTGTGTGG - Intronic
969495912 4:7526032-7526054 CTGAGGAGGAGACAGGTGTGAGG - Intronic
969517189 4:7654366-7654388 CCTGGGATGAGGAGGGTGTGGGG - Intronic
969574348 4:8027911-8027933 GTGGGGATGAGGAATATGTGTGG - Intronic
970011961 4:11469070-11469092 AGGTGCATGAGGAAGGAGTGGGG + Intergenic
970415937 4:15856901-15856923 CTGGGGTTGTGGAAGGTGTGTGG + Intergenic
970443886 4:16108353-16108375 TTGGGGAGGAGAAAGGTGTGGGG + Intergenic
970649809 4:18164348-18164370 CTGAGGATGAGACAGGTGTTGGG - Intergenic
970910584 4:21270273-21270295 CTTTGGTTAAGGAAGGTATGAGG + Intronic
971484603 4:27146402-27146424 CTGAGGATGAGGAATTTGGGGGG + Intergenic
972589832 4:40474351-40474373 CTGTGGGGGAGGTGGGTGTGGGG - Intronic
973779407 4:54274072-54274094 CTGTGTATGTGGATGGAGTGTGG + Intronic
974447909 4:62010304-62010326 GTGTTGAGGGGGAAGGTGTGTGG - Intronic
974784237 4:66597235-66597257 CTGGGGCTTAGGAAGCTGTGTGG - Intergenic
975486204 4:74936076-74936098 CTTTGGATGACCAAGGTGGGAGG - Intronic
976530845 4:86150529-86150551 CTGTGGAGGAGGATGCTCTGGGG - Intronic
977362908 4:96029134-96029156 GTTTGGATGAGGAAGATTTGGGG + Intergenic
978484686 4:109238653-109238675 CTGTGGAACTAGAAGGTGTGTGG + Intronic
980640571 4:135573149-135573171 CTATGGATGAGGAAAGAATGCGG - Intergenic
982026771 4:151259215-151259237 CATTGGATGTGGAAGGTGAGGGG - Intronic
983154254 4:164326754-164326776 CTGTGAATAAGTAAGGTTTGTGG - Intronic
984211369 4:176852746-176852768 CTGAGGAAGAGAAAGGAGTGAGG + Intergenic
984861702 4:184246205-184246227 CTGTTGTTGATGATGGTGTGAGG - Intergenic
984886430 4:184454148-184454170 CTGTGGATGTGGAGTGTGGGAGG - Intronic
985168475 4:187123222-187123244 CTGAGGAGGAGGAAGGAGAGGGG - Intergenic
985855537 5:2421721-2421743 CTGTGGAAGAGGGAGTGGTGGGG - Intergenic
987091681 5:14513278-14513300 CCATGGATGGGGAAGGAGTGGGG + Intronic
987441476 5:17961988-17962010 CTATGTAGGAGGAAGGTTTGGGG + Intergenic
987441586 5:17963339-17963361 CTATGTAGGAGGAAGGTTTGGGG + Intergenic
990531665 5:56679989-56680011 CTGTGGAGGAGGAAGAAGAGTGG - Intergenic
991041423 5:62179790-62179812 CTGTGGAGGATCAAGGTGAGTGG - Intergenic
991080987 5:62599007-62599029 ATGTTGTTGAGGAAGTTGTGGGG - Intronic
992050935 5:72940278-72940300 CTGTAGTTGAGGAAAGAGTGGGG + Intergenic
992383050 5:76257495-76257517 CTGTGTGTGAGGGTGGTGTGTGG + Intronic
993435590 5:87889008-87889030 CTGGGGTTGGGGAAGGGGTGGGG + Intergenic
994316570 5:98339798-98339820 CGGTGGATGAGGAAGGGGTCAGG - Intergenic
995608962 5:113889185-113889207 ATGTGGTTGAGGAAGATGAGTGG + Intergenic
997850177 5:137325405-137325427 CTCTTGATGAGGAGGGTGTTGGG - Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
1001108720 5:168877559-168877581 GTGAGGGTGAGGGAGGTGTGGGG - Intronic
1001566120 5:172700603-172700625 CTGTGGAGGAGTAAGGCGGGAGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1003127630 6:3368217-3368239 ATGTGGAAGAGCAGGGTGTGAGG - Intronic
1003554403 6:7126980-7127002 ATGTGGAGGAGGATGATGTGGGG + Intronic
1004109242 6:12699036-12699058 CTGTGCAGCAGGATGGTGTGAGG - Intergenic
1004163927 6:13239044-13239066 CTGTGGAGGAGCAGGGAGTGGGG + Intronic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005952315 6:30641161-30641183 GTGAGGAAGAGGAAGGAGTGGGG - Intronic
1006055986 6:31384848-31384870 CTGTGGATCAGGAATGTCAGTGG + Intergenic
1006667401 6:35705703-35705725 CTGGGGGTGAGGAGGGTGAGGGG + Intronic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1007274351 6:40662572-40662594 CTATGGCTCAGGAAGGGGTGTGG + Intergenic
1007481429 6:42152889-42152911 CTGTGTGTGTGCAAGGTGTGGGG + Intergenic
1007654989 6:43446462-43446484 TTGTGGATGAGGTAGGGGTGAGG - Intronic
1009510246 6:64541650-64541672 CAGTGGATTAGGAAGGTGAATGG - Intronic
1009601211 6:65802589-65802611 CTGTTGATTAGAAAGATGTGTGG + Intergenic
1010130716 6:72490342-72490364 CTGAGAATGAAGAAGGTGTAAGG + Intergenic
1010843868 6:80680753-80680775 CTAGGGATGAGGAAGATGTCTGG - Intergenic
1011612921 6:89170925-89170947 CTGTGAATGACAAAGGTGTATGG + Intergenic
1012286853 6:97401014-97401036 CTGAGGAGGAGGAAGGGGAGAGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013084972 6:106848804-106848826 CAGAGGATGAGGCAGGAGTGAGG + Intergenic
1013586542 6:111583745-111583767 CTGGGGATGGGGATGGTTTGGGG - Intronic
1013951899 6:115792768-115792790 CTTTTGATGAGGGAGGGGTGGGG + Intergenic
1014051910 6:116964626-116964648 CTGTGTATGTGGAAAGGGTGTGG + Intergenic
1015640126 6:135322861-135322883 CTGTGCATGAGGCAGGTGGCAGG + Intronic
1015882336 6:137881602-137881624 CTTTGGACTTGGAAGGTGTGCGG + Exonic
1016057407 6:139592994-139593016 CTCTGGATGAGCAAAGGGTGAGG - Intergenic
1016177822 6:141101469-141101491 CTGTGGATGATGGAGGTCTCTGG - Intergenic
1016367539 6:143335909-143335931 CTGTGGCTCAGGATGGAGTGTGG - Intronic
1016920159 6:149284912-149284934 GTGGGCATTAGGAAGGTGTGGGG - Intronic
1016986887 6:149901691-149901713 CTGTGGATGAGGAAGGCATCAGG - Intergenic
1017949876 6:159127792-159127814 CTGTGGCTGAGACAGGTGTGTGG + Intergenic
1017980384 6:159395835-159395857 CTGGGGATGACCATGGTGTGGGG + Intergenic
1018176811 6:161184418-161184440 ATGGGGGAGAGGAAGGTGTGTGG + Intronic
1019057864 6:169236030-169236052 GTGTGGATGGGGAGGGAGTGTGG - Intronic
1019057897 6:169236171-169236193 GTGTGGATGGGGAATGAGTGTGG - Intronic
1019057973 6:169236526-169236548 GTGTGGATGGGGAATGAGTGTGG - Intronic
1019058012 6:169236727-169236749 GTGTGGATGGGGAATGAGTGTGG - Intronic
1019126819 6:169846207-169846229 CATTGGCTGAGGAGGGTGTGGGG + Intergenic
1019612613 7:1944656-1944678 CTGTGGAGGAGGAGGGTCTTGGG - Intronic
1019812780 7:3176653-3176675 CAGGGGATGAGGCAGGTGGGGGG + Intergenic
1019857992 7:3628536-3628558 TTGTGGATAAGGATGTTGTGGGG - Intronic
1022985150 7:35646523-35646545 CTGTCGATGAGGCTGGAGTGTGG - Intronic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1025007705 7:55366880-55366902 CTGTGGGAGAGTAAAGTGTGCGG + Intronic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026955489 7:74373863-74373885 CTGGGGCTGAGGAAGGGGTGGGG + Intronic
1027980360 7:85211728-85211750 CTGAGGAGGAGGAAGATGAGGGG - Intergenic
1028163714 7:87514417-87514439 CTGGGGATGAGGGAAGTGTCTGG - Intronic
1028896369 7:96046335-96046357 CTGTGGAAGATGAATTTGTGTGG + Intronic
1031980139 7:128119407-128119429 ATATGGTTGAGGAAGGGGTGAGG - Intergenic
1032240171 7:130153833-130153855 CTGTGGGGGAGGAAGGAGAGTGG + Intergenic
1032510790 7:132470775-132470797 CTGTAGCTGAGGAATGTGGGTGG + Intronic
1033025001 7:137763770-137763792 CTCTGGATGAGGAAGGTGTAAGG - Intronic
1034423649 7:151001798-151001820 CTGCGGGAGAGGAAGGTGTGAGG - Intronic
1034982456 7:155487767-155487789 CTGAGGAGGAGGCGGGTGTGGGG + Intronic
1035425481 7:158769351-158769373 CTGTGTGTGAGAAAGGTGGGTGG - Intronic
1035625833 8:1069813-1069835 TTGTGGAGGAGGATGCTGTGAGG + Intergenic
1035826412 8:2648821-2648843 CAGTGGGTGAGGAAAGCGTGAGG - Intergenic
1036162932 8:6406307-6406329 CTGAGGATCAGGAAGGGGAGGGG - Intergenic
1036727396 8:11231934-11231956 CTCTGCAGGTGGAAGGTGTGGGG - Intergenic
1037115054 8:15215974-15215996 CTGTTGATGAGGAAAGTGTCAGG - Intronic
1038101097 8:24376800-24376822 CGGGGGTTGAGGAGGGTGTGAGG + Intergenic
1038368344 8:26961127-26961149 CTGTGGATGGGGCTGGCGTGGGG - Intergenic
1038520832 8:28230698-28230720 ATGTGGAAGAGGAGGGTTTGTGG - Intergenic
1039214570 8:35255451-35255473 CTCAGGATGAGGATGTTGTGTGG + Intronic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1040818334 8:51531904-51531926 ATGTGGATGATGACGGTGGGGGG - Intronic
1043539169 8:81239993-81240015 ATGTGGATGTTTAAGGTGTGAGG - Intergenic
1044099956 8:88122911-88122933 CTGTAGAGGAGGCAGGGGTGGGG - Intronic
1045280002 8:100741941-100741963 CTGAGGATAAGGTAGGTGGGTGG + Intergenic
1046184183 8:110691251-110691273 TTGTAAATGAGGAAGTTGTGTGG - Intergenic
1046457303 8:114483781-114483803 CTGTGGATGAGGCAGTTCTTAGG + Intergenic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1046765608 8:118066188-118066210 CTGAGGAGGAGGAAGATGAGGGG - Intronic
1047722346 8:127652927-127652949 CTGTGGGCGAGGAAGGAGTCAGG - Intergenic
1047932649 8:129746055-129746077 CTGAGGATGAGCATGGTGCGGGG + Intergenic
1048303765 8:133269268-133269290 CTGTGGAAGAGCTGGGTGTGGGG - Intronic
1048319433 8:133386898-133386920 CTTTGGAAGAGGGAGGGGTGGGG - Intergenic
1048321424 8:133403613-133403635 CCCAGGATGAGGATGGTGTGAGG + Intergenic
1049096571 8:140551733-140551755 CGGTGGATAAGGTAGGTGGGTGG + Intronic
1049104306 8:140601903-140601925 CCGTGGAGGAGGAGGCTGTGAGG - Intronic
1049354816 8:142182438-142182460 CTGTGGCTGTGGACGGTGAGAGG + Intergenic
1049368847 8:142253866-142253888 CAGTGGGTGAGGGAGGTGGGAGG + Intronic
1049779942 8:144424334-144424356 CTGTGGCTGAGGAGGGGTTGGGG - Intronic
1050050249 9:1592554-1592576 CAGTGAGTGAGTAAGGTGTGGGG + Intergenic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1052774984 9:32724169-32724191 CTGTGGATCAGGAATGCGGGTGG + Intergenic
1053061524 9:35035984-35036006 CAGGGGATGAGGGAGTTGTGAGG - Intergenic
1053404505 9:37860401-37860423 CTGGGGTTGAGCAAGGTGGGAGG + Intronic
1056280933 9:85040752-85040774 CTGAGGCTGAGGAGGGGGTGGGG - Intergenic
1057196070 9:93116055-93116077 GTGGGGGTGAGGAAGGGGTGAGG + Intergenic
1057218082 9:93240498-93240520 CTGTGGATGAGGAGTGGGTTGGG + Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057604375 9:96488702-96488724 CCTTGGCTGAGGACGGTGTGAGG - Intronic
1058655793 9:107219374-107219396 TTGTGGATAAACAAGGTGTGTGG - Intergenic
1058824657 9:108764222-108764244 CTGAGGAAGAGGAAAGTGAGGGG - Intergenic
1059112488 9:111570335-111570357 CCGTGGATCAGAAAGGAGTGAGG - Intronic
1059794471 9:117677340-117677362 ATTTGGAAGAGGAAGGGGTGGGG + Intergenic
1060487780 9:124060240-124060262 CTTTGGATGGCGAAGGTGGGAGG + Intergenic
1061074486 9:128332827-128332849 CTGTGGGTGAGGGATGTGTTGGG - Intronic
1061359204 9:130130471-130130493 ATGTGGGCGAGGAACGTGTGTGG + Intronic
1061383953 9:130277156-130277178 CTGGGCAAGAGGAGGGTGTGGGG - Intergenic
1061704422 9:132441885-132441907 CTGATGATTAGGAAGGTCTGGGG - Intronic
1062108551 9:134768970-134768992 GTGTGGAGGGGGGAGGTGTGAGG + Intronic
1062119467 9:134826495-134826517 GTGTGCATGTGGATGGTGTGTGG + Intronic
1062723628 9:138058719-138058741 GTGCTGATGATGAAGGTGTGTGG + Exonic
1186319179 X:8405597-8405619 TTGTAGATGAGAAAGGTGGGAGG - Intergenic
1186495268 X:10008032-10008054 CCATGGAAGAGGATGGTGTGGGG - Intergenic
1186782156 X:12923983-12924005 CTATGGAGGAGGAATTTGTGAGG + Intergenic
1187583238 X:20631681-20631703 ATGTGGTGGAGGAGGGTGTGGGG + Intergenic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1188998198 X:36911965-36911987 CTATGGGTGAGGAAGAAGTGAGG + Intergenic
1190000695 X:46683619-46683641 CTGTGAATAAGGAAGGAGTGTGG + Intronic
1190066387 X:47244536-47244558 ATGGGGATGAGAAAGGTGAGGGG + Exonic
1192168802 X:68841900-68841922 GTGTGGAGGTGGATGGTGTGAGG - Exonic
1193716063 X:84935760-84935782 AGGTGGAAGATGAAGGTGTGGGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196141032 X:112263754-112263776 CTGTGTGTGAGGGAGGGGTGAGG - Intergenic
1197295664 X:124716441-124716463 CAGTGGATGAGGAAGGAGATTGG - Intronic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198244952 X:134821519-134821541 CTTTGGAAGAGGAGGGGGTGGGG - Intronic
1198382988 X:136101553-136101575 CTGTGGATGAGGATGGGAAGAGG + Intergenic
1199474671 X:148232095-148232117 CTGTGGATGATGAGGGCCTGTGG + Intergenic
1199787241 X:151116459-151116481 CTCTGAAGGAGCAAGGTGTGAGG - Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic