ID: 1166993377

View in Genome Browser
Species Human (GRCh38)
Location 19:46706461-46706483
Sequence GGCAAATGGTCTTTGCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166993372_1166993377 0 Left 1166993372 19:46706438-46706460 CCCTGCAAGAAGAGCTTCAGCAG 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1166993377 19:46706461-46706483 GGCAAATGGTCTTTGCACACAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1166993373_1166993377 -1 Left 1166993373 19:46706439-46706461 CCTGCAAGAAGAGCTTCAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 268
Right 1166993377 19:46706461-46706483 GGCAAATGGTCTTTGCACACAGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166993377 Original CRISPR GGCAAATGGTCTTTGCACAC AGG Intronic
902060105 1:13634838-13634860 GGTAGATGATCTTTGCACAGGGG - Intergenic
906538095 1:46563088-46563110 GGCCAAGGGTCTTTGCCTACTGG - Intronic
908934300 1:69356068-69356090 GGTAAATGGACATGGCACACTGG + Intergenic
911660576 1:100497289-100497311 GGGAAATAGTCTGTGCAAACTGG + Intronic
914226906 1:145728198-145728220 GGGAAATGGTCTTGGAACCCTGG + Intronic
915786522 1:158619171-158619193 GGCAAATGGTGGTGGCACAGGGG + Intronic
916197231 1:162235770-162235792 GGCAAGTGCTCCTTGAACACTGG - Intronic
917854866 1:179091871-179091893 GGCACATGATCTGTGCACACAGG - Intronic
920901266 1:210112478-210112500 GGCAAATGGTTTTTGGACCAAGG - Intronic
921326681 1:213991309-213991331 GGCAAATGGTTTTTGCTCATTGG + Intronic
923839794 1:237656858-237656880 GGGAAAGGGTCTTTTCTCACAGG - Intronic
924127350 1:240868820-240868842 GGCAAATGCTCTCTGCAGCCTGG + Exonic
1063284922 10:4676439-4676461 GGTAAATGTATTTTGCACACGGG + Intergenic
1064548938 10:16478965-16478987 GGGAAAAGGCCTTTGCAGACAGG - Intronic
1064585249 10:16833531-16833553 GGCATATGGTCTTTGCATATGGG - Intronic
1067323052 10:45240516-45240538 GGCACATGGTCTTTGCCTATGGG - Intergenic
1069244164 10:66181628-66181650 TGCAAATGGTATTTGCACAGTGG + Intronic
1075943007 10:126407362-126407384 TGCAAAAGGCCTGTGCACACAGG + Intergenic
1078806271 11:14708236-14708258 GTCATGTGGTCTATGCACACTGG + Intronic
1079230879 11:18647759-18647781 GGCAAATGGTTCTTGCACCAAGG + Intergenic
1080994181 11:37580243-37580265 GGCAAATGGTTCTTGGACAAAGG - Intergenic
1081336303 11:41871210-41871232 CTCAAAAGGTGTTTGCACACTGG - Intergenic
1085790774 11:79495717-79495739 GCCAGATGGTCATTGCAAACGGG + Intergenic
1086256672 11:84885178-84885200 GGCAAAGGTTGTTTGCATACTGG + Intronic
1088830183 11:113530235-113530257 AGCAAATGGCCTTGGTACACTGG - Intergenic
1094499492 12:31009367-31009389 GGCAAAAGGTCAGTGCTCACAGG - Intergenic
1095384070 12:41629663-41629685 GGGCACTGGTCTTTGCACTCTGG + Intergenic
1095778552 12:46034843-46034865 GGCAAATGGTCCTTGGACCAAGG + Intergenic
1096555757 12:52402666-52402688 TGCAGGTGGTCTGTGCACACTGG + Intronic
1097101206 12:56590841-56590863 GGCAAAGGGTCCAAGCACACCGG - Exonic
1102577184 12:113863162-113863184 TGGAAATCGTGTTTGCACACAGG + Intronic
1105577628 13:21668909-21668931 CGGAAATGGTCTTTGCTCATTGG + Intergenic
1108083280 13:46759408-46759430 GGCATGTGATCTCTGCACACAGG + Intergenic
1120425169 14:84338486-84338508 GCCTAATGATCTTTGCACCCAGG - Intergenic
1124463607 15:29916365-29916387 GGCACTTGATCTTTACACACAGG + Intronic
1126203671 15:46018590-46018612 GGCAACTGGTGCTTGCACTCAGG - Intergenic
1128293847 15:66500085-66500107 GGCGCATGGTCTTTGCATATGGG + Exonic
1129190908 15:73937115-73937137 GGCAGATGGTCTTTGTCCTCCGG + Intronic
1130726328 15:86443165-86443187 GGCAGATGGTCATTGCAGAAGGG - Intronic
1131396922 15:92093550-92093572 GGCAAATGGTTTTTAAATACCGG - Intronic
1135766038 16:25178635-25178657 GGCAAAGGGGCTTTGCAAATGGG + Intergenic
1137896276 16:52216352-52216374 GGCAAATTGACTTTACTCACAGG - Intergenic
1138447901 16:57076275-57076297 GGCAAATGGTCTTAGCCCCTTGG - Intronic
1141765962 16:86060276-86060298 GGCAAAGGGTCTCTGCAGAGAGG - Intergenic
1141862773 16:86729325-86729347 GGCGAAGGGACTTTGCAGACAGG - Intergenic
1144125256 17:12197081-12197103 GGTAAATTGTCATGGCACACTGG - Intergenic
1144772939 17:17769878-17769900 GGGAAATGGGCTTTGCCCTCAGG + Intronic
1148868065 17:50639456-50639478 GGGAAATGGTCTTGAAACACTGG + Intronic
1149220872 17:54414229-54414251 GGCAAATGGTTTTTGGACCAAGG + Intergenic
1150620081 17:66801596-66801618 TGCAAATGGCCTGTGCACATAGG + Intronic
1151623901 17:75264598-75264620 GACAAATGATTTTTGGACACGGG + Intronic
1152071362 17:78135278-78135300 TGGGAATGGGCTTTGCACACAGG + Intronic
1152454359 17:80404733-80404755 GGCAAATTGACTTTACTCACAGG + Intergenic
1159791124 18:72780078-72780100 GGCAACTGGATTTTGAACACAGG + Intronic
1166993377 19:46706461-46706483 GGCAAATGGTCTTTGCACACAGG + Intronic
1168585851 19:57591125-57591147 GGCTAAAGGACTTTCCACACTGG - Exonic
925904151 2:8529380-8529402 GGCAAATGGGCTTTGAATCCAGG - Intergenic
927669922 2:25060583-25060605 GGCAAATGGGCTTTTCACCTTGG + Intronic
928358527 2:30643852-30643874 GGGAAATGGTCTCTAAACACTGG + Exonic
931157688 2:59653920-59653942 GGCAAATAGTTTCTGCAGACAGG - Intergenic
931376229 2:61710846-61710868 GGCTGATGGACTTTGCACTCAGG - Intergenic
937413564 2:121697018-121697040 GGAAAATGGTTTTTCCTCACAGG - Intergenic
940432150 2:153605131-153605153 GGGAAATGGACTGAGCACACAGG - Intergenic
941422013 2:165294307-165294329 TGAAGATGGTCCTTGCACACTGG - Intronic
943571430 2:189580224-189580246 GGGAAAAGGGGTTTGCACACAGG - Intronic
945529961 2:210940468-210940490 GGGAAAAGGCCTTTGCACATAGG + Intergenic
947022654 2:225698415-225698437 GGAAAAGGGCCTTTGCAAACAGG + Intergenic
947986934 2:234456264-234456286 CGAAATTGGCCTTTGCACACAGG + Intergenic
948822027 2:240554870-240554892 GGCAAATTCTCTTGGCCCACAGG - Exonic
1169336965 20:4764575-4764597 GGAAAAGGGTCTTTGCAAATTGG + Intergenic
1171424615 20:25041857-25041879 GGCCAAAGGCCTTTGCACACTGG + Intronic
1172498238 20:35404775-35404797 GGGAAAAGGTTTTTTCACACTGG - Intronic
1172548100 20:35777497-35777519 GTCAAATGGTATTTGCACTTAGG - Intronic
1173825766 20:46046871-46046893 GGCAGATGCTCATTGCACAGAGG + Intronic
1174983012 20:55418918-55418940 GGCAAAGGGACTTTGCAGATGGG + Intergenic
1178591453 21:33914462-33914484 GGCAAATGGTCTGACCACAGAGG + Exonic
1185130490 22:49035969-49035991 GGCTAAGGGTCTCTGCACTCTGG + Intergenic
949479085 3:4476410-4476432 AGCAAATGGTCTTGGAACAAAGG + Intergenic
957546363 3:81643456-81643478 GGCACATTGTCTTGGCCCACTGG - Intronic
967009380 3:185417770-185417792 GGCGCATGGTCTTTGCATATGGG + Intronic
967052600 3:185798649-185798671 AGCAAATGGTGTTTTCCCACAGG - Intronic
975152443 4:71035875-71035897 GGCAAATGGTTCTTGGACAAAGG + Intergenic
981320233 4:143383785-143383807 GCCAAATAGTCTTGGCACAATGG + Intronic
986237320 5:5924102-5924124 GGCAAATGGTCTTGGTTCACTGG + Intergenic
988706259 5:33728560-33728582 GGCAAATGGCCTTGGCAGAGAGG - Intronic
990624442 5:57595706-57595728 TACAAATGGTCTGTGCACTCAGG - Intergenic
994479855 5:100320897-100320919 GGCAGGTGGTCTATGAACACAGG + Intergenic
997678475 5:135732728-135732750 GGCAAATGGTTCTTGCACCAAGG - Intergenic
997784904 5:136701336-136701358 GGCACATGGTCTCTGCCCTCAGG + Intergenic
998859497 5:146428660-146428682 GGCAAATGGCCCTGGCCCACTGG - Intergenic
1006675808 6:35762257-35762279 GGCAAATGGGCTGGGCACAATGG + Intergenic
1006982030 6:38154721-38154743 TGCAGACGGTCTCTGCACACAGG - Intergenic
1008556140 6:52674657-52674679 AGCAAATGGTTTTTGGACCCAGG + Intronic
1009319098 6:62263777-62263799 GTGAAATGGTCTTGACACACTGG + Intronic
1015605152 6:134946746-134946768 TGCAAATGTGCTATGCACACAGG + Intronic
1015998673 6:139020607-139020629 GGCATATGGGCTGTGCACAGTGG - Intergenic
1019352062 7:559007-559029 GGCAAATGGTCTGTGTCCATGGG - Intronic
1021059640 7:16095209-16095231 GGCAATTTATTTTTGCACACTGG + Intronic
1024544273 7:50503943-50503965 GGAAAATGTTCTCTGTACACGGG - Intronic
1027646254 7:80803349-80803371 GGTAAAAGGCCTTTGGACACAGG - Intronic
1027728116 7:81833361-81833383 AGCAAATGTCCTTTGCACATTGG + Intergenic
1028504014 7:91551848-91551870 GGCAAATTCACTTTGCACAGAGG - Intergenic
1037759569 8:21732985-21733007 GGCAGGAGGTCTTTGCACCCAGG + Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1040465997 8:47695659-47695681 GGAAAGTCTTCTTTGCACACCGG - Intronic
1042438758 8:68799859-68799881 GGCAAATGGTGTTTGAACTGAGG + Intronic
1048175668 8:132149928-132149950 GGCAAATGGTTTCTGCACCAGGG - Intronic
1050623312 9:7477315-7477337 GGCGCATGGTCTTTGCATATGGG + Intergenic
1051135372 9:13914292-13914314 GGCAAATGTTCTGTGAACACTGG + Intergenic
1053065099 9:35062666-35062688 GGCAAATGAACTTTGATCACTGG - Intronic
1054987624 9:71280721-71280743 AGCTAAGGGTCTTTGCACATGGG + Intronic
1055025785 9:71719194-71719216 GGCAAATGATGTTTCCTCACTGG - Intronic
1056190735 9:84181626-84181648 GGCACATGGTGTTTCCCCACTGG - Intergenic
1056992954 9:91427504-91427526 AGAAAATGGTCCTGGCACACAGG - Intergenic
1058572132 9:106358425-106358447 GGCAGTGGGTCTGTGCACACAGG + Intergenic
1058640712 9:107081472-107081494 GGCACATGGTCTTTGAAGCCAGG + Intergenic
1058915231 9:109558730-109558752 GGCAAAAGGCCTGTGCCCACTGG + Intergenic
1059090433 9:111351676-111351698 GGCAAATTGACTTTCAACACGGG - Intergenic
1062167308 9:135114427-135114449 GGAAAAAGGTCTTTGCAGATAGG - Intronic
1062211744 9:135368229-135368251 AGCATGTGGTCTTTCCACACCGG - Intergenic
1203741015 Un_GL000218v1:520-542 AGAAAATGGTCTTTGAACACAGG - Intergenic
1187244061 X:17538322-17538344 AGCAAATGCTCTTTGCTCAGGGG + Intronic
1188557045 X:31424288-31424310 GGCAAATGGGAATTGCACATGGG - Intronic
1189660372 X:43290782-43290804 GGCAAATGCTCTTTTCAAACTGG + Intergenic
1189967454 X:46389537-46389559 GGAAAATGGTCCTTGTTCACTGG - Intergenic
1192504616 X:71673621-71673643 GGCTAAGGGTCTGTGCCCACGGG - Intergenic
1194448202 X:94012115-94012137 GGCAAATAGACTTTACACAAAGG - Intergenic
1194819060 X:98483668-98483690 TACAAATGTTCTTTGCACATAGG + Intergenic