ID: 1166997740

View in Genome Browser
Species Human (GRCh38)
Location 19:46727886-46727908
Sequence CCCGGCCACATGAAGGTAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166997740_1166997753 14 Left 1166997740 19:46727886-46727908 CCTCTTACCTTCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1166997753 19:46727923-46727945 GGAGGCGGGCCAGTCACTTTTGG 0: 1
1: 1
2: 1
3: 51
4: 798
1166997740_1166997751 0 Left 1166997740 19:46727886-46727908 CCTCTTACCTTCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1166997751 19:46727909-46727931 GCTGGGGTGTGCCAGGAGGCGGG 0: 1
1: 0
2: 7
3: 58
4: 642
1166997740_1166997747 -7 Left 1166997740 19:46727886-46727908 CCTCTTACCTTCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1166997747 19:46727902-46727924 GGCCGGGGCTGGGGTGTGCCAGG 0: 1
1: 0
2: 7
3: 111
4: 1050
1166997740_1166997756 17 Left 1166997740 19:46727886-46727908 CCTCTTACCTTCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1166997756 19:46727926-46727948 GGCGGGCCAGTCACTTTTGGGGG 0: 1
1: 0
2: 1
3: 1
4: 61
1166997740_1166997755 16 Left 1166997740 19:46727886-46727908 CCTCTTACCTTCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1166997755 19:46727925-46727947 AGGCGGGCCAGTCACTTTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 60
1166997740_1166997754 15 Left 1166997740 19:46727886-46727908 CCTCTTACCTTCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1166997754 19:46727924-46727946 GAGGCGGGCCAGTCACTTTTGGG 0: 1
1: 0
2: 1
3: 6
4: 78
1166997740_1166997750 -1 Left 1166997740 19:46727886-46727908 CCTCTTACCTTCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1166997750 19:46727908-46727930 GGCTGGGGTGTGCCAGGAGGCGG 0: 1
1: 1
2: 5
3: 93
4: 905
1166997740_1166997749 -4 Left 1166997740 19:46727886-46727908 CCTCTTACCTTCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1166997749 19:46727905-46727927 CGGGGCTGGGGTGTGCCAGGAGG 0: 1
1: 0
2: 6
3: 60
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166997740 Original CRISPR CCCGGCCACATGAAGGTAAG AGG (reversed) Exonic
903522091 1:23958915-23958937 GCCAGCCAGATGCAGGTAAGGGG - Intergenic
910539643 1:88341579-88341601 CCCAGGCACAGGAAGGTAAGTGG + Intergenic
910731281 1:90400018-90400040 TCAGGTCACATGAAGGTTAGAGG - Intergenic
910821212 1:91349348-91349370 CCTGGTCACATGAAGGCGAGAGG - Intronic
918571240 1:185995804-185995826 ACCGGCCACATGAAAATCAGGGG + Intronic
1067538768 10:47136527-47136549 CCAGGCCACCTGAAGGTATCAGG - Intergenic
1075698920 10:124455851-124455873 CCCGGCCAGAAGAAGGTTGGGGG - Intergenic
1079983651 11:27177882-27177904 CCCAGCCATATGAAGATAATGGG - Intergenic
1081765699 11:45608506-45608528 CCCATCCACCTGAAGGGAAGAGG - Intergenic
1087258588 11:95984749-95984771 CCTGGACAGATGAAGGTAACAGG + Intronic
1095435267 12:42180156-42180178 CCAGCCCACATGTAGGGAAGGGG - Intronic
1103194949 12:119035976-119035998 TCAGGCCACATGAAGGGAAAAGG + Intronic
1110354566 13:74552325-74552347 CCGGGCCTCGTGAAGGTAGGGGG + Intergenic
1112790216 13:102995039-102995061 CCAGGCCACATTAATGTAAGTGG + Intergenic
1132210962 15:100021737-100021759 CCAGGGTAGATGAAGGTAAGGGG + Intronic
1139324047 16:66138073-66138095 CCCAGCCACATCAAAGGAAGAGG + Intergenic
1140033901 16:71358815-71358837 CTCGGCCAGGTGCAGGTAAGGGG - Exonic
1143330411 17:6130878-6130900 CCAGCCCACATGCAGGTGAGGGG + Intergenic
1143906120 17:10210495-10210517 CACGGTCACCTGAAGGTCAGAGG + Intergenic
1149284238 17:55144270-55144292 CCCAGCCTCATGAAGGAATGGGG + Intronic
1157571353 18:48714382-48714404 CCCCACCATATGAAGGGAAGGGG + Intronic
1163119751 19:15210358-15210380 CCCGGCCACATGGAGTACAGGGG + Intergenic
1165385509 19:35508197-35508219 TCCAGCAACATGAGGGTAAGAGG - Intronic
1166997740 19:46727886-46727908 CCCGGCCACATGAAGGTAAGAGG - Exonic
1168451084 19:56467143-56467165 GCCGGCCACATCATGCTAAGGGG + Intronic
932493016 2:72133442-72133464 CCCGGCAACATGAAGCTCAGAGG - Intronic
932575921 2:72962299-72962321 CCATGCCACAGGCAGGTAAGGGG + Intronic
932581488 2:72995174-72995196 CCCGGCTACACGAGGGTGAGAGG - Intronic
933278962 2:80311391-80311413 CCCAGCCAGATGAAGGAGAGGGG - Intronic
938563605 2:132496718-132496740 CCCAGCCACATGGGGGAAAGTGG - Intronic
943699748 2:190976832-190976854 CCAGGCCAAAGGAAGGTAAGTGG - Exonic
948806808 2:240456589-240456611 GCCGGACACATGATGGTAATGGG - Exonic
1169379706 20:5096010-5096032 CCCAGCCACATGCTGGTAAAGGG + Intronic
1171369721 20:24653796-24653818 GGCGGCCACATGAAGGAGAGTGG - Intronic
1172886027 20:38231317-38231339 CCCGGCCACCTGGAGGACAGAGG + Exonic
1182300233 22:29333078-29333100 CAGGGTCACATGAGGGTAAGTGG + Intronic
951529274 3:23683647-23683669 CCAGGGTACATGAAGGGAAGAGG - Intergenic
952326221 3:32322813-32322835 CCCAGCCACATGAAAGAAAAAGG - Intronic
953720656 3:45351953-45351975 CCAGGACACAGGAAGGTAAGAGG + Intergenic
955046815 3:55368553-55368575 CCTGGCCACATGAATGTCATCGG + Intergenic
960927950 3:122815046-122815068 CCAGCCCACAGGAGGGTAAGTGG + Intronic
969440315 4:7213054-7213076 CCCTGCCACATGAATGGCAGTGG - Intronic
972125599 4:35761040-35761062 CCCTGCCTAATGAAGATAAGAGG - Intergenic
978205936 4:106081472-106081494 CACGGCCACATGGTGGTGAGGGG + Intronic
981543077 4:145865989-145866011 CCAGTCCACATGATGGAAAGGGG - Intronic
984701167 4:182819617-182819639 CCCGGCCTCCCGCAGGTAAGTGG + Intergenic
984988299 4:185352491-185352513 GACGGACACATGAAGGAAAGAGG - Intronic
985682790 5:1265271-1265293 CCAGGCCACAGGAAGGGCAGGGG - Intronic
985824162 5:2180420-2180442 CCCGGCCAAATGAAGGAAAACGG + Intergenic
987023333 5:13897794-13897816 CCCTCCCCCATGAAGGGAAGAGG - Intronic
988848307 5:35152853-35152875 CCAGGCAAAATGAAGGGAAGTGG + Intronic
995911701 5:117195512-117195534 TCCTGCCACATGAAGTGAAGTGG - Intergenic
996306566 5:122053948-122053970 CCCCGCCACTTGAAGTCAAGTGG - Intronic
1000970066 5:167704210-167704232 GGTGGCCTCATGAAGGTAAGTGG - Intronic
1008194940 6:48507090-48507112 ACAGGCCACATGAGGGCAAGTGG - Intergenic
1016447310 6:144147304-144147326 CTTGGCCACATGGAGGTCAGTGG - Intergenic
1017991544 6:159493353-159493375 CACGGTCACATGAAGGTCACTGG + Intergenic
1023447971 7:40251592-40251614 CACTCCCACATGAAGGTACGTGG + Intronic
1031885315 7:127240263-127240285 CCAGGCCACCTGAAGGCAAGAGG - Intronic
1045702416 8:104881974-104881996 CCTGGCCCCATGAAGTTAGGTGG + Intronic
1048302620 8:133262611-133262633 CCAGGCCACATGAAAGGAGGAGG - Intronic
1049016582 8:139924362-139924384 CCCGGCCACATGGAGCTGAAGGG + Intronic
1049603377 8:143518271-143518293 CCCAGCCATGTGAAGGTCAGGGG - Intronic
1050704975 9:8386571-8386593 CCTGGCCCTATGAAGGGAAGTGG - Intronic
1051376825 9:16410420-16410442 CCTGGGTACATGAAGGTCAGAGG - Exonic
1060214697 9:121731716-121731738 CCCGGGCACCTGGAGGTCAGTGG - Intronic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic