ID: 1166998842

View in Genome Browser
Species Human (GRCh38)
Location 19:46733052-46733074
Sequence GCTGCTGGTGAAACAGATCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166998842_1166998855 21 Left 1166998842 19:46733052-46733074 CCTCGATCTGTTTCACCAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1166998855 19:46733096-46733118 GCAGGGCCTGGTGGAGCCCTGGG 0: 1
1: 0
2: 3
3: 72
4: 565
1166998842_1166998851 12 Left 1166998842 19:46733052-46733074 CCTCGATCTGTTTCACCAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1166998851 19:46733087-46733109 CTGAGCCCTGCAGGGCCTGGTGG 0: 1
1: 1
2: 5
3: 77
4: 654
1166998842_1166998844 3 Left 1166998842 19:46733052-46733074 CCTCGATCTGTTTCACCAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1166998844 19:46733078-46733100 TCCCCACCACTGAGCCCTGCAGG 0: 1
1: 0
2: 3
3: 25
4: 293
1166998842_1166998854 20 Left 1166998842 19:46733052-46733074 CCTCGATCTGTTTCACCAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1166998854 19:46733095-46733117 TGCAGGGCCTGGTGGAGCCCTGG 0: 1
1: 2
2: 10
3: 63
4: 577
1166998842_1166998850 9 Left 1166998842 19:46733052-46733074 CCTCGATCTGTTTCACCAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1166998850 19:46733084-46733106 CCACTGAGCCCTGCAGGGCCTGG 0: 1
1: 0
2: 5
3: 91
4: 618
1166998842_1166998857 23 Left 1166998842 19:46733052-46733074 CCTCGATCTGTTTCACCAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1166998857 19:46733098-46733120 AGGGCCTGGTGGAGCCCTGGGGG 0: 1
1: 0
2: 6
3: 66
4: 456
1166998842_1166998846 4 Left 1166998842 19:46733052-46733074 CCTCGATCTGTTTCACCAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1166998846 19:46733079-46733101 CCCCACCACTGAGCCCTGCAGGG 0: 1
1: 0
2: 3
3: 40
4: 335
1166998842_1166998856 22 Left 1166998842 19:46733052-46733074 CCTCGATCTGTTTCACCAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1166998856 19:46733097-46733119 CAGGGCCTGGTGGAGCCCTGGGG 0: 1
1: 1
2: 7
3: 48
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166998842 Original CRISPR GCTGCTGGTGAAACAGATCG AGG (reversed) Exonic
902904845 1:19548744-19548766 ACTGCTGGAGAAACAGCTCAAGG - Intergenic
904434994 1:30489070-30489092 GGTGGTGGTGATACAGATGGTGG + Intergenic
905914133 1:41673403-41673425 GCTGCTGGGGAAACTGAGTGAGG - Intronic
906237849 1:44222574-44222596 GGTGGTGGTGAAACAAATCCTGG - Intronic
907393929 1:54176763-54176785 GCTGCTGGTGAGACGGATAGGGG + Intronic
911051785 1:93677541-93677563 GCTGATGGTGAAACCCATGGAGG + Intronic
911717241 1:101147208-101147230 GCTGATGGTGACACATATCTGGG + Intergenic
913150119 1:116033443-116033465 GCTGGTGGTGAGAGAGAACGGGG - Intronic
914847901 1:151292923-151292945 GCTGCTGGTGGAGCAGATGGTGG - Exonic
916661264 1:166924081-166924103 GCCCCTGGTGAAACAGAACTAGG - Intronic
917665879 1:177224986-177225008 GCTGCTGGTGTACCAGATCTTGG - Intronic
918276702 1:182959754-182959776 GCAGCTGGAGACAGAGATCGAGG - Intergenic
919786793 1:201263184-201263206 GCTGGTGGGGAAACTGATCTCGG + Intergenic
921348828 1:214214661-214214683 GCTGCTGGTGAAGCAGGAGGAGG - Intergenic
1062786707 10:271057-271079 GGTGCTGGTGAAAAAGCTGGAGG + Intergenic
1064143150 10:12806952-12806974 GCTGCTGGCCAAACACATCATGG + Intronic
1075319950 10:121483428-121483450 GCTGCTGGTGGAGCAGTCCGGGG - Intronic
1075693233 10:124415030-124415052 AGTGCTGGTGGCACAGATCGTGG - Intronic
1075993436 10:126857462-126857484 GCTGCTGATGTAACAGAAGGTGG - Intergenic
1076305267 10:129461637-129461659 GCTGCTGATCAGACAGATGGAGG + Intergenic
1076320244 10:129574621-129574643 ACTTCTGGTGACACAGCTCGAGG - Intronic
1076715312 10:132361057-132361079 GAAGCTGGAGAAACAGATCTGGG + Intronic
1077842933 11:5994551-5994573 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG + Intronic
1082883251 11:58058752-58058774 GCAGCTGCAGAAGCAGATCGGGG - Intronic
1084379014 11:68798759-68798781 GCTGCAGGAGAAACAGCTCACGG + Intronic
1089707463 11:120290078-120290100 GCTGCTGTTGAAACAGACCTCGG + Intronic
1093538082 12:20247205-20247227 GCTGCTGGGGAAAGAGAAAGGGG - Intergenic
1095143814 12:38699645-38699667 GGTACTGGTGAAATAGACCGTGG - Intronic
1096634715 12:52950840-52950862 GCAGCTGGAGACAGAGATCGAGG + Exonic
1099144324 12:79020241-79020263 GCTGCTGGTTAAACTGATTTAGG - Intronic
1102801011 12:115733912-115733934 TCAGCTGGTAAAACAGCTCGGGG - Intergenic
1106287205 13:28328458-28328480 GCGGCTGGTGAAGCAGCTCCGGG - Intronic
1107232151 13:38122999-38123021 GCTGCTGGAGAAAGAGAGCATGG + Intergenic
1110695309 13:78481201-78481223 GCTGCTGGAAAAACATAACGAGG - Intergenic
1114189549 14:20430099-20430121 TCAGCTGGTGCAACAGATCTGGG + Exonic
1120101980 14:80455254-80455276 GCTGCTGGAGAAAGAGTTCATGG - Intergenic
1121495515 14:94389270-94389292 GATGCAGGTGAAACAGTTCCTGG - Intronic
1124796628 15:32787447-32787469 GCTGCTAGTGAAACTGACCTGGG - Intronic
1129595590 15:76961503-76961525 TCTGCTGGGGAAACAGACCCAGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133248707 16:4466081-4466103 GCCGTTGGTGTAACAGACCGCGG - Intronic
1135613810 16:23892001-23892023 GCTGTTGGTGATACAGCTCTAGG - Intronic
1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG + Intergenic
1142291808 16:89196494-89196516 GCTGGTGGGGCAACAGATTGGGG + Intronic
1143587613 17:7858407-7858429 CCTGCTGCTGAAACCCATCGTGG + Exonic
1143920925 17:10330545-10330567 CCTGCTGGGGAAAAAGATCAAGG - Intronic
1144657795 17:17048750-17048772 GCTGCTGTGGAAACAGTTTGGGG + Intronic
1144737445 17:17563090-17563112 CCTGCTGCTGAGACAGATCTTGG - Intronic
1144873103 17:18382551-18382573 GGAGCTGGAGGAACAGATCGCGG + Exonic
1145201697 17:20951341-20951363 TCTCCTGCTGAAACAGATCCAGG + Intergenic
1146308626 17:31750113-31750135 GCTGTTACTGAAAAAGATCGTGG - Intergenic
1149582840 17:57763211-57763233 GCTCCTGGTGAAGCAGGTGGGGG - Intergenic
1150241551 17:63637965-63637987 CCTGCTGGGGGAACAGATCCTGG - Intronic
1152683757 17:81683693-81683715 GCTGCTGGTGAAACGGCTGCAGG - Exonic
1160467525 18:79094083-79094105 ACTGGTGGTGAAACAGAACTGGG - Intronic
1160733366 19:651123-651145 GCTCCTGGTGGAACAGAGCCTGG - Intronic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1161528069 19:4769675-4769697 CCCGGTGCTGAAACAGATCGCGG - Intergenic
1161550770 19:4910831-4910853 GGTGCTGGTAAAACTGATGGGGG + Intronic
1162422252 19:10572519-10572541 GCTACTGGGGGAACAGACCGTGG + Intergenic
1163013785 19:14441370-14441392 GCTGCTGGTGCAGCAGGTCGAGG - Exonic
1164161561 19:22628562-22628584 GCTGCTGGTCAACCAGACTGTGG + Intergenic
1164409526 19:27989192-27989214 GCAGCTGGTGAAAGAGAAGGTGG - Intergenic
1164934346 19:32199644-32199666 GGTGCTAGTGAAACATTTCGAGG - Intergenic
1165556130 19:36634100-36634122 GCTGCTGATGAAGCAGAGCTAGG - Intergenic
1166998842 19:46733052-46733074 GCTGCTGGTGAAACAGATCGAGG - Exonic
926121730 2:10244964-10244986 GCTGCTGTTGGAAGAGATGGGGG + Intergenic
927820750 2:26262032-26262054 GCTGCTGGTGAAGGAGATAAAGG - Intronic
932580853 2:72991911-72991933 GATGCTGTTAAAACAGATCCTGG - Intronic
935553718 2:104484747-104484769 GATACAGGTGAAACAGATAGGGG - Intergenic
936399599 2:112155482-112155504 GAGGCTGATGAAACAGAGCGTGG - Intronic
942536137 2:176966712-176966734 GCTGTTGGGGAATCAGATCTTGG - Intergenic
943548660 2:189311928-189311950 GCAGCTGGAGACAGAGATCGAGG - Intergenic
944636240 2:201678527-201678549 GGTGCTGGTGAAATAGCTCTGGG + Intronic
948229105 2:236336718-236336740 GCTGTTGGTGTTACAGATGGTGG - Intronic
948668945 2:239554125-239554147 CCTGCTGGGGAGACAGATCTTGG + Intergenic
1172135312 20:32682752-32682774 GCGGCTGGTGAAGGAGATCAAGG - Intergenic
1172968762 20:38858311-38858333 GGTGCTGGAGAAACTGATGGGGG + Intronic
1174349587 20:49957333-49957355 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1175959248 20:62626659-62626681 GCTGCTGGTGAAAGTGACCGTGG - Intergenic
1176055935 20:63149110-63149132 GCTGCTGGGAAAACAGATGCTGG - Intergenic
1179295174 21:40055191-40055213 GCTGCTGGGGAAACAGCTGCAGG + Intronic
1184693514 22:46127963-46127985 GCAGCTGGTGACACAGGTGGGGG - Intergenic
1184752029 22:46491988-46492010 GGTGCTGGTGAAACAGACGTGGG - Intronic
949919087 3:8987442-8987464 GAGTCTGGTGAAACAGATGGTGG + Intronic
951486748 3:23221455-23221477 GCTGGTGGTGAAAGAGCTGGGGG - Intronic
952319142 3:32259528-32259550 GCAGCTGGAGACAGAGATCGAGG + Intronic
954714465 3:52520256-52520278 GCTGCAGGAGAAAGAGATGGGGG - Exonic
955488439 3:59458371-59458393 TCTGCTGGGGAAAGAGATGGGGG + Intergenic
957080627 3:75633123-75633145 GCTGCTGGAGAAACAGCACAGGG - Intergenic
961168949 3:124782299-124782321 GCTTCTGGTCAAACAGATATGGG - Intronic
963001737 3:140688023-140688045 GATCCTGGTGGACCAGATCGAGG + Exonic
963118425 3:141754139-141754161 GCTGCTGCTTAAACAGATAAGGG + Intergenic
969092678 4:4706952-4706974 AATGCTGGTGAAACAGGTGGAGG + Intergenic
969531053 4:7730500-7730522 GCTGCTGAAGAAACAAATTGTGG + Intronic
970628113 4:17912288-17912310 GCAGCTGGAGACACAGATCGAGG + Intronic
971175358 4:24277381-24277403 GCTGCTTGGGAAACAGTTGGGGG - Intergenic
972538722 4:40020830-40020852 GCAGCTGGAGACAGAGATCGAGG + Intergenic
974484349 4:62487890-62487912 CCTGCTGATAAAACAGATTGTGG - Intergenic
977012046 4:91648481-91648503 GCTGCTGGAGAAACAGATTTTGG + Intergenic
981268685 4:142818653-142818675 GCTGCTGGCTACACGGATCGGGG - Intronic
985340966 4:188954041-188954063 GTTGCTGCTGAAACAGTTTGCGG - Intergenic
985827790 5:2205436-2205458 GCTGCTGGTGAAGCCCAGCGTGG - Intergenic
987715069 5:21557868-21557890 GCAGCTGGTGCAACAGGTTGGGG - Intergenic
993548041 5:89237796-89237818 GATGAAGGTGAAACAGATTGAGG - Intergenic
993632099 5:90299074-90299096 GCTGCTGGTGAGAGAGGTAGGGG + Intergenic
996452057 5:123636697-123636719 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1000197308 5:158972186-158972208 GCAGCTGGGGACACAGATTGAGG - Intronic
1000268309 5:159658850-159658872 TGTGCTGGGGAAACAGATCCTGG - Intergenic
1002043635 5:176530596-176530618 GCTCCTGGTGCAGCGGATCGTGG + Exonic
1002307446 5:178292188-178292210 GCTGGTGCAGGAACAGATCGAGG - Intronic
1005682721 6:28222901-28222923 GATGATGGTGAAACAGAACATGG - Intergenic
1005761213 6:28969810-28969832 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1006293892 6:33161325-33161347 GGTGCGGGAGAAACAGATGGGGG + Intergenic
1009001654 6:57724176-57724198 GCGGCTGGTGCAACAGGTTGGGG + Intergenic
1010169561 6:72958882-72958904 GCTGTTAGTGAAATAGATCCTGG - Intronic
1013667332 6:112362117-112362139 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1013931373 6:115537979-115538001 AATGCTGGTGAAGCAGACCGAGG - Intergenic
1014009241 6:116457997-116458019 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1018058141 6:160070024-160070046 GCTGCAGGTGAATCGGATGGTGG - Exonic
1019258735 7:68046-68068 GTTCCTGTTGAAACAGGTCGGGG + Intergenic
1019399515 7:844237-844259 GCTGCAGGTGAGAGAGATCCTGG - Intronic
1020105977 7:5422516-5422538 GCTGCTGCAGACAGAGATCGAGG - Intronic
1020435821 7:8161362-8161384 GCTGGTGGTGGAACAGAGAGGGG + Intronic
1022772362 7:33487635-33487657 GCTGCTGGAGGAAGAGATCTGGG + Intronic
1023401655 7:39795925-39795947 ACTGCAGGTGAAACAGATGCTGG - Intergenic
1025849683 7:65235828-65235850 GCTGCTGCTCAACCAGATGGTGG - Intergenic
1033545651 7:142397742-142397764 GCTCCTGGTGGAACAGGACGGGG + Intergenic
1033599919 7:142881981-142882003 TCTGCTCATGAAACAGATGGAGG + Intronic
1033611299 7:142965518-142965540 GATGATGGAGAAACAGATCATGG + Intergenic
1034738053 7:153447217-153447239 GCTGCTGGGGTTTCAGATCGTGG + Intergenic
1036453845 8:8891993-8892015 GCTGCAGGGGAACCAGATCGCGG - Exonic
1039695200 8:39903136-39903158 TCTGCTGGTGCAACAGATTAAGG + Intronic
1042319541 8:67460834-67460856 GCTGACTGTGAAACAGATTGAGG - Intronic
1046374538 8:113359442-113359464 TCTGCTGAGGAAACAGAGCGGGG + Intronic
1048683416 8:136873244-136873266 CATGCTGGAGAAACAGATTGTGG - Intergenic
1051214928 9:14786899-14786921 GCTCCTGGTGAAACCTCTCGTGG - Intronic
1051379475 9:16440809-16440831 GCTTCTGGTGAAAGAGATCCAGG + Intronic
1052611041 9:30774028-30774050 GCAGCTGAAGACACAGATCGAGG + Intergenic
1052612995 9:30800140-30800162 GCAGCTGGAGACACAGTTCGAGG - Intergenic
1054870507 9:70044113-70044135 GCTCCTAGTGAAAGGGATCGTGG - Exonic
1055708851 9:79037086-79037108 GCAGGTGGAGACACAGATCGAGG - Intergenic
1056920818 9:90787231-90787253 CCTGCTGGTCAAACAGAGGGTGG + Intergenic
1057552757 9:96064083-96064105 GCTTCGGGTGAAACAGATCCAGG - Intergenic
1059717154 9:116923905-116923927 GCTTCTGGAGAGACAGATCTAGG - Intronic
1059958861 9:119545630-119545652 GCTGATGGTGAATCAGATATAGG + Intergenic
1060348610 9:122838134-122838156 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1061895518 9:133644890-133644912 GATGCTGGTGCAACAGAGAGAGG - Intronic
1062207476 9:135345114-135345136 GCTGCTGGTGAGAAAGACGGCGG + Intronic
1186176142 X:6927793-6927815 GATCCTGGTGAAACAGGTGGTGG + Intergenic
1186519768 X:10195077-10195099 GCTGCTGGTGAATCAGTCAGAGG + Exonic
1189670594 X:43404416-43404438 ACTGCTGGAGAAGCAGATCTGGG + Intergenic
1197617897 X:128715093-128715115 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1200085876 X:153604737-153604759 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1202381427 Y:24278671-24278693 ACTGCAGGTGAAACAGATGCTGG - Intergenic
1202489358 Y:25391455-25391477 ACTGCAGGTGAAACAGATGCTGG + Intergenic