ID: 1167002824

View in Genome Browser
Species Human (GRCh38)
Location 19:46756026-46756048
Sequence CGCCCTGGACGGAGATGCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167002812_1167002824 14 Left 1167002812 19:46755989-46756011 CCCGCTATGGCGCAGCCCCCGCC 0: 1
1: 0
2: 2
3: 8
4: 168
Right 1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 152
1167002815_1167002824 -2 Left 1167002815 19:46756005-46756027 CCCCGCCGCGCCCCGCTGCGACG 0: 1
1: 0
2: 3
3: 32
4: 270
Right 1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 152
1167002817_1167002824 -4 Left 1167002817 19:46756007-46756029 CCGCCGCGCCCCGCTGCGACGCC 0: 1
1: 0
2: 3
3: 38
4: 448
Right 1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 152
1167002811_1167002824 17 Left 1167002811 19:46755986-46756008 CCGCCCGCTATGGCGCAGCCCCC 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 152
1167002813_1167002824 13 Left 1167002813 19:46755990-46756012 CCGCTATGGCGCAGCCCCCGCCG 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 152
1167002818_1167002824 -7 Left 1167002818 19:46756010-46756032 CCGCGCCCCGCTGCGACGCCCTG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 152
1167002814_1167002824 -1 Left 1167002814 19:46756004-46756026 CCCCCGCCGCGCCCCGCTGCGAC 0: 1
1: 0
2: 1
3: 36
4: 365
Right 1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 152
1167002816_1167002824 -3 Left 1167002816 19:46756006-46756028 CCCGCCGCGCCCCGCTGCGACGC 0: 1
1: 0
2: 2
3: 25
4: 245
Right 1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167002824 Original CRISPR CGCCCTGGACGGAGATGCTG TGG Exonic
900185019 1:1328870-1328892 CTCCCAGGAGGGAGACGCTGGGG + Exonic
901019430 1:6248423-6248445 AGCCATGGAGGGAGATGATGTGG + Exonic
901095723 1:6677788-6677810 CGCCCTGGGCAGCCATGCTGTGG - Intronic
902089673 1:13893199-13893221 CTCCCTGGACTGAGACGCCGCGG + Intergenic
904403024 1:30269347-30269369 AGCCCTGGAGGGAGCTGCTTTGG + Intergenic
909075429 1:71046765-71046787 GGCACTGGACTGAGATGCCGTGG + Exonic
916824890 1:168433690-168433712 AGACCTGGAGGGAGATGCTTGGG - Intergenic
920950479 1:210567706-210567728 TGTCCTAGATGGAGATGCTGTGG + Intronic
921414167 1:214869589-214869611 CGTCCTGGAGGGAGATGGGGGGG - Intergenic
1063783723 10:9356287-9356309 CACCCTGGCCGGACATGGTGAGG + Intergenic
1064464193 10:15562918-15562940 GGGCCTGGTGGGAGATGCTGGGG + Intronic
1069890419 10:71648942-71648964 GGCCCTGCAGGGAGATGGTGGGG + Intronic
1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG + Intronic
1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG + Intronic
1074754578 10:116615081-116615103 TGACCTGGAGGGAGATGCAGTGG + Intergenic
1075868480 10:125749205-125749227 CGCCCAGGCTGGAGATGCAGTGG - Intronic
1076316051 10:129542296-129542318 CGACCTGCACGGAGAGGCCGTGG - Intronic
1077087990 11:764181-764203 GGCCCTGGTGGGAGATGCTTGGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083885283 11:65570494-65570516 GGCCCTGAACGGAGCTGGTGAGG + Exonic
1084210365 11:67618771-67618793 CTCCCTGGACTGAGAAGCAGTGG - Intergenic
1085037366 11:73308436-73308458 CGCCCGGGATGGAGACGTTGCGG + Exonic
1085387089 11:76163616-76163638 CACTCTGGACGGAGGTGCTGGGG + Intergenic
1088540739 11:110911212-110911234 CGCCCTGAAAGGAGAAGCTCAGG + Intergenic
1088676787 11:112202014-112202036 CTCCCTGGAAGGAGCTGCAGGGG - Exonic
1089129909 11:116203370-116203392 AGCCCTGGAGGGAGATCCAGGGG - Intergenic
1092104374 12:5911004-5911026 CTCCCTGCCCGCAGATGCTGGGG - Intronic
1092288394 12:7143192-7143214 CACCCTGGAGGGGGATGATGTGG + Exonic
1096904162 12:54917492-54917514 TGCACTGGACGGAGCTGCAGCGG - Intergenic
1102561573 12:113766197-113766219 TGCCCTGGACAAACATGCTGGGG - Intergenic
1104205078 12:126631197-126631219 CCCCCGGGCAGGAGATGCTGTGG + Intergenic
1106225587 13:27783979-27784001 CTCCCTGGAAGGAGATAATGTGG + Intergenic
1108556852 13:51601813-51601835 CGCTCTGGAAGAAGATGCAGAGG + Intronic
1110615799 13:77540669-77540691 GGCACTGGAAGGAGTTGCTGTGG + Intronic
1121775703 14:96589166-96589188 AGGCCTGGAGGAAGATGCTGAGG + Intergenic
1122442438 14:101741282-101741304 AGCCATGGCCGGAGATGCAGTGG + Intergenic
1122930953 14:104932916-104932938 CGGCCTGGACGGACAGGCTCCGG + Exonic
1123497865 15:20847884-20847906 CTCCCTGAACAGAAATGCTGAGG + Intronic
1123555095 15:21421511-21421533 CTCCCTGAACAGAAATGCTGAGG + Intronic
1123591341 15:21858843-21858865 CTCCCTGAACAGAAATGCTGAGG + Intergenic
1123717044 15:23040632-23040654 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123717069 15:23040704-23040726 CCACCTGGCCGGAGGTGCTGGGG + Intergenic
1123717126 15:23040894-23040916 TGACCTGGCCAGAGATGCTGGGG + Intergenic
1123717207 15:23041156-23041178 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123717283 15:23041418-23041440 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123717296 15:23041454-23041476 CCACCTGGCCGGAGGTGCTGGGG + Intergenic
1123717680 15:23042749-23042771 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123717779 15:23043082-23043104 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123717845 15:23043307-23043329 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123717858 15:23043343-23043365 CCACCTGGCCGGAGGTGCTGGGG + Intergenic
1123717876 15:23043387-23043409 CTACCTGGCCGGAGGTGCTGGGG + Intergenic
1123718149 15:23044349-23044371 CGACCTGGCCAGAGATGCTGGGG + Intergenic
1123718226 15:23044611-23044633 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123718364 15:23045115-23045137 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123718462 15:23045449-23045471 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123718527 15:23045675-23045697 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123718540 15:23045711-23045733 CCACCTGGCCGGAGGTGCTGGGG + Intergenic
1123718558 15:23045755-23045777 CTACCTGGCCGGAGGTGCTGGGG + Intergenic
1123718734 15:23046410-23046432 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123718830 15:23046744-23046766 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123718897 15:23046970-23046992 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123718959 15:23047188-23047210 TGACCTGGCCAGAGATGCTGGGG + Intergenic
1123719035 15:23047450-23047472 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123719110 15:23047713-23047735 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123719173 15:23047931-23047953 TGACCTGGCCAGAGATGCTGGGG + Intergenic
1123719249 15:23048193-23048215 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1123719490 15:23049018-23049040 CCACCTGGCCAGAGATGCTGGGG + Intergenic
1125601143 15:40916349-40916371 CCCCCTGGGCAGTGATGCTGGGG + Intergenic
1127384506 15:58456532-58456554 GCCCCTGGAGGGAGGTGCTGGGG + Intronic
1202963442 15_KI270727v1_random:148721-148743 CTCCCTGAACAGAAATGCTGAGG + Intergenic
1134605190 16:15565168-15565190 GGCCCTTGATGGAGACGCTGAGG + Intronic
1136417704 16:30113714-30113736 AGCCCAGGACGGGGCTGCTGGGG - Exonic
1138278161 16:55751308-55751330 CGCCCTGGGCAGAGCTGCAGGGG + Intergenic
1142005702 16:87688689-87688711 CGGGCAGGACGGGGATGCTGGGG + Intronic
1142708845 17:1712630-1712652 AGGGCTGGAGGGAGATGCTGTGG + Intergenic
1142794449 17:2296640-2296662 TTCCATGGACGGAGATGTTGGGG - Intronic
1143319744 17:6060334-6060356 AGCCCTGGACAGAGATGGAGGGG + Intronic
1146664331 17:34687232-34687254 TGCCCTGGATGGAAATCCTGGGG - Intergenic
1147316974 17:39625673-39625695 CACCCAGGACCCAGATGCTGGGG + Intergenic
1147546504 17:41406164-41406186 AGCATGGGACGGAGATGCTGAGG + Intergenic
1148164751 17:45475545-45475567 CGCCCTGCTCCGGGATGCTGAGG - Exonic
1149909003 17:60551682-60551704 CGTCCTGGAGGGAGATGGGGGGG + Intergenic
1150395970 17:64822212-64822234 CGCCCTGCTCCGGGATGCTGAGG - Intergenic
1153914270 18:9732201-9732223 CCCCCTGGACGAAGATGGTCTGG - Intronic
1154954855 18:21243146-21243168 CGCCCTGGCCGGGGAGGGTGAGG + Intronic
1158954106 18:62523411-62523433 CGCCCTAGCCGAGGATGCTGAGG + Exonic
1159182240 18:64923705-64923727 CGCCCAGGCTGGAGTTGCTGTGG + Intergenic
1160856542 19:1220475-1220497 CGCCCAGGTCGGAGATTTTGAGG - Exonic
1160985294 19:1835854-1835876 AGCCCTGGCTGGAGAGGCTGGGG - Intronic
1161039158 19:2100801-2100823 GGCCTTGGGTGGAGATGCTGGGG + Intergenic
1166000100 19:39872627-39872649 CACCGTGGACGGCGAGGCTGTGG - Exonic
1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG + Exonic
925309865 2:2874940-2874962 GGCTCTGGGCGGAGGTGCTGGGG - Intergenic
926756827 2:16243271-16243293 AGCCCTGGACTGAGAGGCAGAGG - Intergenic
927246767 2:20962897-20962919 CTCCCTGGGAGGAGATGCTAAGG + Intergenic
927941576 2:27106654-27106676 CGCCCAGGCTGGAGTTGCTGTGG + Intronic
934854111 2:97718409-97718431 CCCCATGGCCAGAGATGCTGGGG - Intronic
935071381 2:99697104-99697126 TGCCCTGGACTGAGATTCCGAGG - Intronic
936418791 2:112345011-112345033 CGACCAGGACGGAGAGGGTGAGG + Intergenic
936982036 2:118273736-118273758 CGCCCTGGACGTAGGCACTGAGG - Intergenic
938221200 2:129569361-129569383 CTCCCTGGACAGAGAAACTGGGG + Intergenic
939684227 2:145177830-145177852 CGGCCTGGATGTAGATCCTGGGG + Intergenic
946249507 2:218403980-218404002 AGCCCTGGAGGCAGAGGCTGTGG + Intronic
946419683 2:219557826-219557848 CCACCTGGACGGTGAAGCTGAGG + Exonic
947489130 2:230578857-230578879 CACCCTGGGTGGAGAAGCTGAGG - Intergenic
948934957 2:241157841-241157863 CAACCTGGACAGAGATGCAGAGG + Exonic
1174089506 20:48035814-48035836 GGCCCAGGAAGGAGATGATGAGG + Intergenic
1176023325 20:62973531-62973553 AGCCCTGGAGGGACATGCGGGGG - Intergenic
1179175142 21:39002898-39002920 GGCCCTGGAAGGAGGTGCAGTGG - Intergenic
1179897407 21:44370343-44370365 CAACCTTGACGGAGAAGCTGGGG - Intronic
1179922253 21:44513638-44513660 CGCCCTCGAGGGAGCTGTTGGGG - Intronic
1182485194 22:30635169-30635191 CGCCCTGGACTGGGAGGCTGGGG + Intergenic
1183371317 22:37434041-37434063 CTCCCTCCAGGGAGATGCTGGGG + Intergenic
950728436 3:14935088-14935110 CCCACTGGACCCAGATGCTGGGG + Intergenic
950880146 3:16316863-16316885 TGCCAGGGACGGGGATGCTGAGG - Exonic
952451710 3:33439876-33439898 CGCCCTGGACGCGGAGGCCGCGG - Exonic
954156608 3:48688503-48688525 GGTCCTGGACTCAGATGCTGAGG - Exonic
954257810 3:49418539-49418561 CGCCCTGGCTGGAGGTGCAGTGG + Intronic
954608877 3:51933835-51933857 AGCCCTTGACTGTGATGCTGAGG - Intronic
961746684 3:129068361-129068383 GGCCCTTGACGGGGAGGCTGGGG + Intergenic
961870523 3:129984437-129984459 GGCCCTAGAGGGAGATGGTGGGG + Intergenic
966807554 3:183818862-183818884 GGCCCTGGAGGGAGAGGATGAGG + Intronic
967990705 3:195128271-195128293 CGCCCTGGTGGGTGATGATGTGG - Intronic
970596586 4:17605689-17605711 CGGCCTGGAAGAAGATGATGGGG - Intronic
973281401 4:48363801-48363823 CGTCCGGGAGGGAGATGCGGGGG - Intronic
978735173 4:112076930-112076952 CGCCCTGCCCTGAGATGCTGTGG + Intergenic
980464076 4:133151397-133151419 CCCCCTGGACCGAGAGGCGGGGG + Exonic
985545851 5:508617-508639 CGCCTGGGATGGAGATGCCGCGG + Intronic
986716104 5:10524772-10524794 CCCCCTGGGCGCAGATGGTGTGG - Intergenic
998367162 5:141638964-141638986 AGGCCTTGAAGGAGATGCTGGGG + Exonic
998924057 5:147103056-147103078 GGCCCAAGACTGAGATGCTGGGG - Intergenic
999285491 5:150391995-150392017 TGGCCTGGACGGAGGTGCTCTGG - Exonic
999327095 5:150650212-150650234 CGCCCTGGAGGGAGACACGGGGG - Exonic
999929892 5:156420014-156420036 GTCCCTGGAAGGAGAGGCTGAGG - Intronic
1001423501 5:171605700-171605722 GACCCTGGACTGAGATCCTGAGG - Intergenic
1002484271 5:179523886-179523908 GGCCTTGGACAGGGATGCTGGGG + Intergenic
1002500303 5:179643602-179643624 GGCCTTGGACAGGGATGCTGGGG - Intronic
1016314540 6:142771517-142771539 CTCCCTGGACGGTGATACCGTGG + Exonic
1016378656 6:143450534-143450556 AGCCCGGGAGGTAGATGCTGCGG - Intronic
1016996131 6:149963571-149963593 CGCCCTGGACGGAGAGGGGCGGG + Intergenic
1017012064 6:150069586-150069608 CGCCCTGGACGGAGAGGGGCGGG - Intergenic
1018374254 6:163195872-163195894 CGAGCTGGGAGGAGATGCTGGGG - Intronic
1019594589 7:1852488-1852510 CTCCCTGGGCGGAGAGGCTGGGG + Intronic
1019744170 7:2690294-2690316 CGCCCTGGAGGTCGAGGCTGTGG - Intronic
1022375331 7:29806778-29806800 GGCCCGGGACAGAGATCCTGAGG + Intronic
1022663565 7:32387812-32387834 CGTCCTGGAGGGAGGTGGTGGGG - Intergenic
1024816252 7:53275334-53275356 GGACCTGGATGGAGATGCAGGGG + Intergenic
1027361750 7:77416461-77416483 CGCCCTGGCCTGAGAAGCTCCGG + Intergenic
1035827421 8:2659771-2659793 CGCTCTGGAGGCAGATGCTGGGG - Intergenic
1040052784 8:43033028-43033050 CGCCCGGGAGGGAGGTGGTGGGG - Intronic
1042611737 8:70607985-70608007 CGTCCTGGGCGGAGAAGCCGGGG + Intronic
1048272542 8:133041134-133041156 TGCCCTGGGGGGAGATGATGTGG + Intronic
1049744469 8:144257402-144257424 AGCCCAGGAAGGAGGTGCTGGGG - Intronic
1056604696 9:88076823-88076845 CGGCCTGGCGGGAGATGCAGGGG - Intergenic
1057112313 9:92484952-92484974 GGCCCTGGAATAAGATGCTGGGG + Intronic
1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG + Intergenic
1060778842 9:126396955-126396977 CGCCCTGGAGGGCACTGCTGAGG + Intronic
1061803945 9:133127927-133127949 GGCCCTGGACGGGGATGCAGAGG + Intronic
1062077479 9:134598727-134598749 GGCCCTGGAAGGGGAAGCTGAGG + Intergenic
1196785221 X:119415928-119415950 AGCCCTGGAGGTAGAGGCTGCGG + Intronic