ID: 1167004037

View in Genome Browser
Species Human (GRCh38)
Location 19:46763874-46763896
Sequence ACTATGTAGCGTCTTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167004037_1167004040 11 Left 1167004037 19:46763874-46763896 CCAGATGCAAGACGCTACATAGT 0: 1
1: 0
2: 1
3: 15
4: 101
Right 1167004040 19:46763908-46763930 CCAATGTAAAATTCTAGAAGAGG 0: 1
1: 0
2: 3
3: 15
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167004037 Original CRISPR ACTATGTAGCGTCTTGCATC TGG (reversed) Intronic
901097756 1:6695905-6695927 ACTATGTAGGGCTTTGCAGCTGG - Intronic
905483430 1:38277287-38277309 AATATGTAGCCTCTTGAATCCGG + Intergenic
905642268 1:39598691-39598713 AATAGGTAGCCTTTTGCATCTGG - Intergenic
914427353 1:147589575-147589597 AATATGTAGTCTTTTGCATCTGG + Intronic
916711015 1:167408600-167408622 AATATGTAGTCTCTTGCATCTGG - Intronic
917703734 1:177609965-177609987 ACTATGTGGCTTTTTGCATCAGG + Intergenic
919855293 1:201702119-201702141 AATATGTGGCCTTTTGCATCTGG - Intronic
923481412 1:234388649-234388671 AGTATGTAGCCTTTTGGATCTGG - Intergenic
1065812432 10:29454660-29454682 AATATGTGGCCTTTTGCATCTGG + Intergenic
1067710512 10:48647928-48647950 ACTGTGTAGTGTTTTGCATTGGG - Intronic
1070089750 10:73272693-73272715 ATTATGTAGCTTCTTGGTTCAGG + Intronic
1072293425 10:93987764-93987786 ACTATGTGGTGTCTTCCATGAGG - Intergenic
1074351439 10:112741040-112741062 ACTATGTGGTCTCTTGTATCTGG - Intronic
1079049448 11:17140544-17140566 ACTATGTAGTTTTTTACATCTGG - Intronic
1080487901 11:32730342-32730364 AATATATAGCCTCTTGAATCTGG + Intronic
1084515071 11:69633435-69633457 GCTATGCAGCCTCTTGCATCTGG - Intergenic
1091787518 12:3252047-3252069 ACTTTGTAGCTTCTAGCACCTGG + Intronic
1101794649 12:107961629-107961651 AGTATGTATCATTTTGCATCTGG + Intergenic
1103584074 12:121937975-121937997 ACAATGTATAGTCTTTCATCTGG + Intronic
1110598072 13:77340884-77340906 AATATGTAGCCTCTTGTGTCTGG - Intergenic
1112039914 13:95536633-95536655 ACTATGAAGCGCCTTGAATTAGG - Intronic
1116069107 14:40020353-40020375 AACATGTAGCTTCTTGGATCGGG - Intergenic
1116575165 14:46565328-46565350 ACTATGTAGAGTCCTGTATTTGG + Intergenic
1128492224 15:68159566-68159588 AATATGTAGCCTTTTGCGTCTGG + Intronic
1128886857 15:71295910-71295932 ACTGTGTGGTCTCTTGCATCTGG + Intronic
1129428872 15:75483452-75483474 ACTATGTAGCTTTTTGTGTCTGG - Intronic
1130951316 15:88591481-88591503 AGTATGTGGCCTTTTGCATCTGG + Intergenic
1138904411 16:61313559-61313581 ACTTTGAAGCTTCTTGCATGTGG - Intergenic
1141030295 16:80581731-80581753 ATCATGTAGTGTCTTGCACCTGG + Intergenic
1146151065 17:30472712-30472734 ACTCTGAAGCCTCTTGCCTCTGG - Intergenic
1147337035 17:39732687-39732709 ACTATGTGGCCTTTTGCTTCTGG + Intergenic
1150027665 17:61694341-61694363 AATATGTAGCATTTTGTATCTGG + Intronic
1163089224 19:15007278-15007300 ACTATGTGGCCTTTTGTATCTGG - Intronic
1163119261 19:15206834-15206856 ACTATGTAGCCTTTTGTGTCTGG + Intergenic
1163686188 19:18713100-18713122 ACTATGTGGCGTTTTGTGTCTGG + Intronic
1165272265 19:34720879-34720901 ACTATGTAGCTTTTTGAGTCTGG - Intergenic
1167004037 19:46763874-46763896 ACTATGTAGCGTCTTGCATCTGG - Intronic
1167282647 19:48579062-48579084 ACTATGTGGCCTCTTGTGTCTGG + Intronic
927283800 2:21335735-21335757 AATATGTAGCCTATTGTATCTGG + Intergenic
928338022 2:30414885-30414907 AATATGTGGCCTTTTGCATCTGG + Intergenic
934723281 2:96596901-96596923 ACTATGTTGTGCCCTGCATCAGG - Intronic
937472379 2:122185312-122185334 ACGCTGGAGGGTCTTGCATCAGG + Intergenic
938859006 2:135347037-135347059 AATATGTAGCCTTTTGTATCTGG + Intronic
939869349 2:147509717-147509739 ACTATGTAGGGTGTTACATTAGG + Intergenic
940427638 2:153549001-153549023 ACTATGTAGCCTCTTGTGTCTGG - Intergenic
942922129 2:181387885-181387907 AATATGTGGCCTTTTGCATCTGG - Intergenic
945004012 2:205383802-205383824 AATATGTAGCCTTTTGGATCTGG + Intronic
947792947 2:232878138-232878160 ACTTTGTAGCGTCTTCCCACAGG - Intronic
948301658 2:236912240-236912262 ACTACGTAGCCTCTTCCTTCCGG + Intergenic
1170326900 20:15165987-15166009 AATATGTAGCCTTTTGCATCTGG - Intronic
1173312693 20:41914036-41914058 ACAATCTAGTGTCTTGCATTAGG + Intergenic
1175180027 20:57139551-57139573 AATATGTGGCCTTTTGCATCTGG + Intergenic
1178284123 21:31310676-31310698 AGTAGGTAGCGTTTTCCATCAGG - Intronic
1181795676 22:25307516-25307538 AGTCTGTAGTCTCTTGCATCTGG + Intergenic
1181836165 22:25610726-25610748 AGTCTGTAGTCTCTTGCATCTGG + Intronic
1182267347 22:29127973-29127995 AATATGTAGCCCTTTGCATCTGG - Intronic
1184904877 22:47475070-47475092 TCTCTGTAGCCTCTTGCATCAGG - Intronic
949393849 3:3593681-3593703 ACTGTGTAGTGTTTTGCATCTGG + Intergenic
952492917 3:33888892-33888914 ACTTTGTCGCATCTTGCTTCAGG - Intergenic
953284343 3:41591991-41592013 AGCATGTGGAGTCTTGCATCCGG + Intronic
956544200 3:70381578-70381600 ACTCTGTAGTGTCTCACATCAGG - Intergenic
957199519 3:77114028-77114050 ACGAAGTAGCCTCTTTCATCGGG + Intronic
962394101 3:134999767-134999789 CCTATAAAGCGTCTTGCCTCAGG + Intronic
966988932 3:185208920-185208942 AATATGTAATGTTTTGCATCTGG - Intronic
967428699 3:189357067-189357089 ACTATATAGCATTTTACATCAGG - Intergenic
974926217 4:68301554-68301576 ATTATATAGCTTTTTGCATCTGG - Intergenic
979776557 4:124595924-124595946 AGTATGTTGCCTCTTGCATCTGG - Intergenic
981123309 4:141077377-141077399 CATATGTAGCCTTTTGCATCTGG - Intronic
982596274 4:157388868-157388890 ACTAAGAAGGGTCTTGCTTCAGG - Intergenic
983960478 4:173747130-173747152 AATATGTAGCATCTTGTATTTGG - Intergenic
986255453 5:6099505-6099527 AGTATGTAGCCTTTTGTATCTGG - Intergenic
987102348 5:14603079-14603101 AGTATGTAGCTTTTTGAATCTGG + Intronic
987333984 5:16882642-16882664 AATATGTAGCCTTTTGTATCTGG - Intronic
990039567 5:51362976-51362998 AATATGTAGCCTCTAGAATCTGG + Intergenic
990369771 5:55105512-55105534 ACCATGTAGGGTCTTGAATGAGG - Exonic
990418804 5:55612556-55612578 AATATGTAGTCTTTTGCATCTGG + Intergenic
996084709 5:119292790-119292812 AGTATGTAGCCTTTTGCATCTGG - Intronic
996675337 5:126168362-126168384 ACTATGCAGTGTCCTGCATCTGG - Intergenic
1001784636 5:174401550-174401572 ACTATGTAGCTGCTTGCCTAGGG + Intergenic
1003309819 6:4960515-4960537 AATATGTGGCCTTTTGCATCTGG - Intergenic
1003690385 6:8347656-8347678 ACTGTGTAGAGTGTGGCATCAGG + Intergenic
1004204589 6:13580540-13580562 ACTATGTAGCCTTTTGTATCTGG + Intronic
1004631477 6:17425723-17425745 ATTATGTAGCGTCTTTACTCAGG + Intronic
1005519990 6:26592126-26592148 AGTATGTAGCATTTTGTATCTGG + Intergenic
1011655544 6:89548282-89548304 ACTATGTGGTGTTTTGTATCTGG + Intronic
1016094924 6:140023522-140023544 AGTATGTAGTCTTTTGCATCTGG + Intergenic
1017301002 6:152857737-152857759 ACTATGCAGACTGTTGCATCTGG - Intergenic
1024384316 7:48734242-48734264 ACTTTCTAGAGTCTTGCATATGG - Intergenic
1028160002 7:87475244-87475266 TCTTTGAAGGGTCTTGCATCCGG - Intronic
1031700610 7:124920317-124920339 AGCATGTAGCCTTTTGCATCTGG - Intronic
1038182284 8:25240557-25240579 ACTATGTGGTCTTTTGCATCTGG + Intronic
1041099781 8:54384228-54384250 AATATGTGACGTTTTGCATCTGG + Intergenic
1041215988 8:55600606-55600628 ACTATGTGACCTTTTGCATCTGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1044709629 8:95044117-95044139 AATATGTAGCTTTTTGTATCTGG - Intronic
1047868396 8:129055113-129055135 ACTATGTAGCATCTTCTCTCTGG - Intergenic
1049045116 8:140143868-140143890 ACTATGTATGGTCTGCCATCTGG + Intronic
1050179265 9:2902206-2902228 AGTATGTAGCCTTTTGAATCTGG + Intergenic
1050246673 9:3697350-3697372 CCTATGAAGCTTCTTGCTTCAGG - Intergenic
1050406660 9:5315581-5315603 ACTTTGGAGCTTCTTGAATCTGG - Intergenic
1051607677 9:18931268-18931290 AATATGTAGCGTTTTGCATCTGG + Intronic
1053477359 9:38392358-38392380 ATTAAGCAGCGTCTTGCAGCGGG + Intergenic
1185600913 X:1338620-1338642 ACTATGTATCTTTTTGTATCTGG - Intronic
1186446724 X:9636046-9636068 AATATGTGACCTCTTGCATCTGG - Intronic
1186517624 X:10178020-10178042 AGTATGTGGCCTCTTGCATCTGG - Intronic
1186747821 X:12587526-12587548 AAGATGTAGCCTTTTGCATCTGG + Intronic
1187400484 X:18955233-18955255 ACTATGTAGCCTTTGGCATCTGG - Intronic
1187819341 X:23269904-23269926 ACTATGTAGCCTCTTGCGCCTGG + Intergenic
1188517883 X:31006957-31006979 AATATGTACTCTCTTGCATCTGG + Intergenic
1189538893 X:41965808-41965830 ACAATTTACCCTCTTGCATCTGG - Intergenic
1190001105 X:46687932-46687954 AATATGTAGCCTCTTGTGTCTGG + Intronic
1192298571 X:69876690-69876712 AATATGTAGGTTTTTGCATCTGG + Intronic
1193827053 X:86239450-86239472 AATATGTAGTCTTTTGCATCTGG + Intronic
1194023878 X:88726859-88726881 AGTATATGGCTTCTTGCATCGGG - Intergenic
1195737372 X:108027402-108027424 ACTATGTGGCCTTTTGTATCTGG - Intergenic
1196197519 X:112851691-112851713 ACTATGTAGCTTCTACCTTCAGG + Intergenic
1197826139 X:130592197-130592219 AGTATGTGGCCTTTTGCATCTGG + Intergenic
1202047351 Y:20748275-20748297 ACTGTGTGGCCTTTTGCATCTGG + Intergenic