ID: 1167004037

View in Genome Browser
Species Human (GRCh38)
Location 19:46763874-46763896
Sequence ACTATGTAGCGTCTTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167004037_1167004040 11 Left 1167004037 19:46763874-46763896 CCAGATGCAAGACGCTACATAGT No data
Right 1167004040 19:46763908-46763930 CCAATGTAAAATTCTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167004037 Original CRISPR ACTATGTAGCGTCTTGCATC TGG (reversed) Intronic