ID: 1167006164

View in Genome Browser
Species Human (GRCh38)
Location 19:46777713-46777735
Sequence TGGTATGGGCAGGATCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 610}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167006164_1167006183 29 Left 1167006164 19:46777713-46777735 CCCACCAGATCCTGCCCATACCA 0: 1
1: 0
2: 2
3: 38
4: 610
Right 1167006183 19:46777765-46777787 CCAGTCTGTCCCTTGGCCCAAGG 0: 1
1: 0
2: 2
3: 27
4: 262
1167006164_1167006179 22 Left 1167006164 19:46777713-46777735 CCCACCAGATCCTGCCCATACCA 0: 1
1: 0
2: 2
3: 38
4: 610
Right 1167006179 19:46777758-46777780 CACGTCCCCAGTCTGTCCCTTGG 0: 1
1: 0
2: 0
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167006164 Original CRISPR TGGTATGGGCAGGATCTGGT GGG (reversed) Intronic
900833524 1:4982191-4982213 TGTCATGGGAAAGATCTGGTGGG - Intergenic
901324818 1:8360046-8360068 TGGTGGGGGCAAGTTCTGGTGGG - Intronic
901492918 1:9605761-9605783 TGGTGTGAGCAGGAGCTGGGAGG + Intronic
901844069 1:11971148-11971170 TGGAAGGGGCAGGAGTTGGTGGG + Intronic
902115449 1:14117259-14117281 TATTGTGGGAAGGATCTGGTGGG + Intergenic
902166421 1:14575498-14575520 TGTTTTGGGAGGGATCTGGTGGG - Intergenic
902696955 1:18146551-18146573 AGGTGTGGGCAGCATGTGGTTGG - Intronic
903941608 1:26935605-26935627 TGTCATGGGAAGGACCTGGTGGG - Intronic
904202598 1:28830998-28831020 TGGTGGGGACAGCATCTGGTGGG - Intronic
904367231 1:30021385-30021407 TGTCATGGGAAGGACCTGGTAGG - Intergenic
904446245 1:30575058-30575080 TGTTATGGGAGGGACCTGGTGGG + Intergenic
904927932 1:34063113-34063135 TGCTGTGGGAAGGATCAGGTGGG - Intronic
905003887 1:34694997-34695019 TGGCATGGGCTGGATCAGGCAGG + Intergenic
905333826 1:37229530-37229552 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
905641489 1:39593006-39593028 AGGTATGAGCAGGATGTGGCTGG - Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
905948200 1:41921329-41921351 TGTCATGGGAAGGACCTGGTGGG + Intronic
906687791 1:47773468-47773490 TGTTGTGGGAGGGATCTGGTGGG + Intronic
906763859 1:48408873-48408895 TGCTATGGGAGGGACCTGGTGGG - Intronic
906891420 1:49719738-49719760 TGCTATGGGAGGGATCTGGTGGG + Intronic
907439388 1:54469520-54469542 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
907688226 1:56635185-56635207 TGTCATGGGGAGGACCTGGTGGG + Intronic
907721457 1:56976075-56976097 TGTCATGGGAGGGATCTGGTGGG + Intergenic
908536994 1:65087583-65087605 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
908915937 1:69126423-69126445 TGTTGAGGGCAGGACCTGGTAGG - Intergenic
909271470 1:73628295-73628317 TGTTATGGGAGGGACCTGGTGGG - Intergenic
909602784 1:77478323-77478345 TGTTGTGGGAGGGATCTGGTGGG + Intronic
911246379 1:95522913-95522935 TGTTGTGGGGGGGATCTGGTGGG + Intergenic
911765860 1:101673814-101673836 TGTTTTGGGAAGGACCTGGTGGG + Intergenic
912080756 1:105932821-105932843 TGTTGTGGGCGGGACCTGGTGGG + Intergenic
912155628 1:106915252-106915274 TGGTACAGGCAGGATGTGGGTGG - Intergenic
912934540 1:113991690-113991712 TGGTCTGGAAAGGATCTGGCTGG + Intergenic
912969448 1:114266883-114266905 TGGTGTGGGAGGGAGCTGGTGGG - Intergenic
913223391 1:116677556-116677578 TGGTAAGAGCAGGATATAGTAGG - Intergenic
913534079 1:119754863-119754885 AGGGATGGGCAAGATCTGTTTGG - Intronic
914231735 1:145768185-145768207 GGGGATGGGCAGGATCTGAGCGG - Intronic
915107898 1:153545840-153545862 TGCTATGGGCAGGGCCTGGCTGG - Exonic
915219092 1:154359649-154359671 TGTTATGGGAGGGACCTGGTGGG - Intergenic
917494166 1:175525037-175525059 TGGCATGGGAGGGACCTGGTGGG + Intronic
918718024 1:187817335-187817357 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
918815384 1:189173984-189174006 TGTTATGGGAGGGACCTGGTGGG - Intergenic
918949824 1:191123119-191123141 TGTTGTGGGAAGGAACTGGTTGG - Intergenic
918976061 1:191488101-191488123 TGTCATGGGAAGGACCTGGTGGG + Intergenic
919242839 1:194936656-194936678 TGTTGTGGGAAGGACCTGGTAGG + Intergenic
919551174 1:198989871-198989893 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
920439834 1:205972543-205972565 TGGTGTTGGCAGGACTTGGTTGG + Intergenic
921497411 1:215858351-215858373 TGTCAAGGGCAGGACCTGGTGGG + Intronic
921609590 1:217195443-217195465 TGTCATGGGAAGGACCTGGTGGG + Intergenic
921628523 1:217404764-217404786 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
921912040 1:220560197-220560219 TGTTGTGGGAAGGACCTGGTGGG - Intronic
922190506 1:223314584-223314606 TGTTATGGGAGGGACCTGGTGGG + Intronic
922336386 1:224621862-224621884 TGTTGTGGGAAGGATCTGGTGGG + Intronic
922766624 1:228159445-228159467 TGGTATGGGCATCAGTTGGTGGG + Exonic
923154913 1:231269606-231269628 TGTGATGGGCTGGGTCTGGTAGG + Intronic
923932672 1:238720728-238720750 TGTTATGGGAGGGACCTGGTGGG - Intergenic
924040366 1:239978707-239978729 TGTTATGGGAGGGACCTGGTAGG + Intergenic
1063877212 10:10492789-10492811 TGTTGTGGGAAGGACCTGGTTGG + Intergenic
1064222444 10:13453378-13453400 TCGTAAGGTCAAGATCTGGTAGG + Intronic
1065217807 10:23467139-23467161 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1065401668 10:25309658-25309680 TGTCATGGGCATGACCTGGTTGG + Intronic
1066040634 10:31545507-31545529 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1066270041 10:33813465-33813487 TGATGTGGGAGGGATCTGGTGGG - Intergenic
1066633133 10:37476455-37476477 TGGTATGGTTTGGATGTGGTCGG + Intergenic
1067368761 10:45662017-45662039 CAGCATGGGCAGGTTCTGGTGGG - Intronic
1067691623 10:48505609-48505631 TGGTTGGGGCAGGACCTGGCTGG + Intronic
1067852158 10:49761118-49761140 CTGTATGGGCAGGAACTAGTAGG - Intronic
1068367033 10:56065006-56065028 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1068948470 10:62753922-62753944 TATCAAGGGCAGGATCTGGTGGG + Intergenic
1069166598 10:65167876-65167898 TGTTGTGGGAAGGAACTGGTGGG - Intergenic
1070918897 10:80171813-80171835 TGGCAGTGGCAGGATCTGGATGG + Intronic
1073645647 10:105299911-105299933 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1074128607 10:110552661-110552683 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1074360171 10:112819521-112819543 TGGTTTGGGGAGGGTCTGATTGG + Intergenic
1074620399 10:115113481-115113503 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1075803729 10:125170178-125170200 TGGTGGGGGCAGGAGCTGGTGGG + Intergenic
1075923998 10:126235925-126235947 TGGGCTGCGCAGGACCTGGTTGG + Intronic
1075938508 10:126365731-126365753 TGTTGTGGGAGGGATCTGGTGGG - Intronic
1075964955 10:126603421-126603443 TGTTATGGGAGGGACCTGGTGGG - Intronic
1076856635 10:133118684-133118706 TGTTGAGGGCAGGACCTGGTGGG - Intronic
1078308797 11:10218352-10218374 TGTCATGGGAGGGATCTGGTGGG - Intronic
1079625494 11:22612071-22612093 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1080129942 11:28782245-28782267 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1080182453 11:29441690-29441712 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1080275890 11:30503074-30503096 TGTTGTGGGAAGGATCTGGTGGG + Intronic
1080401218 11:31937748-31937770 TGTTGAGGGAAGGATCTGGTGGG - Intronic
1080841285 11:35985609-35985631 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1080904119 11:36523224-36523246 TGTTATGGGAAGGACCTGGTGGG + Intronic
1081175271 11:39920719-39920741 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1081746908 11:45479767-45479789 TGGTATGGGGAGGAAATGATTGG + Intergenic
1081812406 11:45921524-45921546 TGGTATGTGCAGGCCCTGGTTGG + Intergenic
1081838230 11:46175449-46175471 CGGCATGGGCAGGGGCTGGTGGG - Intergenic
1083493566 11:63031007-63031029 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1085577503 11:77620194-77620216 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1085698347 11:78724776-78724798 TGATATGGGCAGCTTCTGGGAGG + Intronic
1086015813 11:82166300-82166322 TAGTATTGGCAGGAACTGATTGG + Intergenic
1086502814 11:87470977-87470999 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1087307146 11:96500994-96501016 GGTTATGGGCAGCATCTTGTTGG - Intronic
1087603621 11:100347043-100347065 TGTTATGGGAGGGACCTGGTGGG - Intronic
1088013905 11:105036465-105036487 TGTTATGGGAGGTATCTGGTGGG + Intergenic
1088326093 11:108602926-108602948 TGTTGAGGGCAGGACCTGGTGGG + Intergenic
1089379549 11:118017946-118017968 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1090935531 11:131338543-131338565 TGTTATGGGAGGGATCCGGTGGG - Intergenic
1091332795 11:134743822-134743844 TGGGATGGGGAGGAAATGGTGGG - Intergenic
1091644529 12:2263780-2263802 CGAGATGGGCAGGAGCTGGTTGG + Intronic
1094277055 12:28689321-28689343 TGGTGCGGGAGGGATCTGGTGGG + Intergenic
1094426146 12:30319220-30319242 GGGTCTGGGCAGGACCTGGTTGG - Intergenic
1095191057 12:39258546-39258568 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1095308036 12:40661503-40661525 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1095522716 12:43086058-43086080 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1096544923 12:52331480-52331502 TGTTATGGGCAGAATGTGCTCGG - Intergenic
1096887026 12:54728286-54728308 TGTTAGGGCCAGGACCTGGTGGG - Intergenic
1098090455 12:66895216-66895238 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1099654948 12:85478445-85478467 TGATATGGGAGGGATCTGGTAGG - Intergenic
1099700274 12:86074884-86074906 TGTTGTGGGAGGGATCTGGTAGG - Intronic
1099722721 12:86383944-86383966 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1099923665 12:88990734-88990756 TGGTTTGGGCAGAATTTGGCAGG + Intergenic
1099928977 12:89052202-89052224 TGTTTTGGGAAGGACCTGGTGGG - Intergenic
1100052257 12:90462573-90462595 TGTTATGGGCAGAATCTGGAGGG - Intergenic
1100436600 12:94576901-94576923 AGGAATGGGTAGGATCTGGGTGG - Intronic
1100698465 12:97120532-97120554 TGGTGTGGGAGGGATCTGGTGGG + Intergenic
1101005666 12:100398766-100398788 TGTTATGGGAGGGACCTGGTGGG + Intronic
1101413050 12:104485012-104485034 AGGTAGGGGCAGGCTCTAGTAGG + Intronic
1101512391 12:105404971-105404993 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1101826611 12:108225389-108225411 TGTCATGGGAAGGACCTGGTGGG - Intronic
1102299931 12:111763996-111764018 TGTTATGGGAAGAACCTGGTGGG - Intronic
1102339179 12:112108490-112108512 CGGTCTGGGCAGCAGCTGGTCGG - Intronic
1102666882 12:114581691-114581713 TGTTAAGGGCGGGACCTGGTGGG - Intergenic
1102669642 12:114606723-114606745 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1102870307 12:116408945-116408967 CAGTATGGCCAGGTTCTGGTTGG - Intergenic
1103881445 12:124169118-124169140 TGGTGTGGGAGGGACCTGGTGGG + Intronic
1104084269 12:125459790-125459812 TGTTATGGGAGGGACCTGGTGGG + Intronic
1104096474 12:125562654-125562676 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1104452918 12:128885962-128885984 TGTTGTGGGAAGGACCTGGTGGG + Intronic
1104528791 12:129549374-129549396 TGTTGTGGGAAGGACCTGGTGGG + Intronic
1104676371 12:130714764-130714786 TGGGATGGGCAGGGTCTGACCGG - Intronic
1105074086 12:133260117-133260139 TGTTAGGGGAAGGACCTGGTGGG - Intergenic
1106394380 13:29366383-29366405 TGTTATGGGAGGGACCTGGTGGG - Intronic
1107554321 13:41504253-41504275 TGTCATGGGAGGGATCTGGTGGG - Intergenic
1108729966 13:53224896-53224918 TGGCATGGGAAGGACCTGGTGGG + Intergenic
1109285589 13:60404850-60404872 TGTTGTGGGAAGGACCTGGTGGG + Intronic
1109391937 13:61705087-61705109 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1109875992 13:68405301-68405323 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1109890472 13:68605269-68605291 TGTTATTGGAAGGACCTGGTGGG + Intergenic
1110149920 13:72238971-72238993 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1110511306 13:76354718-76354740 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1110511569 13:76356662-76356684 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1110553285 13:76830517-76830539 TCGTATGGCAAGGATCTGGATGG + Intergenic
1110955231 13:81545829-81545851 TGTCATGGGAGGGATCTGGTGGG - Intergenic
1110997820 13:82136256-82136278 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1111221151 13:85207040-85207062 TGTTGAGGGCAGGACCTGGTGGG + Intergenic
1111494390 13:89029273-89029295 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1111725635 13:92004882-92004904 TGTTATGGGAGGGACCTGGTGGG - Intronic
1112119381 13:96392971-96392993 TGCTATGGGAGGGACCTGGTGGG + Intronic
1112194050 13:97207590-97207612 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1112722202 13:102258194-102258216 TGTTATGGGAGGGACCTGGTGGG - Intronic
1112941477 13:104867068-104867090 TGTCATGGGAGGGATCTGGTGGG - Intergenic
1113357107 13:109591413-109591435 TGGTAAGAGCAGTATCTGGTAGG + Intergenic
1113587762 13:111476896-111476918 TGTTGGGGGCAGGACCTGGTGGG + Intergenic
1114987811 14:28252072-28252094 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1115007284 14:28500385-28500407 TGTTATGGGAGGGAACTGGTGGG - Intergenic
1116047816 14:39765746-39765768 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1116068914 14:40018060-40018082 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1116138770 14:40960741-40960763 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1116337331 14:43673791-43673813 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1116602699 14:46947514-46947536 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1118047132 14:61982548-61982570 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1118468662 14:66054753-66054775 TGTTGTGGGCGGGACCTGGTGGG + Intergenic
1118481043 14:66166112-66166134 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1118668838 14:68100853-68100875 TAGTGTGGTCAGGATCTGGGTGG - Intronic
1118945648 14:70384584-70384606 TGTCATGGGAAGGACCTGGTGGG + Intronic
1118964849 14:70571274-70571296 TGGTGTGGGAAGGACCCGGTAGG + Intergenic
1119033798 14:71213066-71213088 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1119143105 14:72285308-72285330 TGTTGTGGGAAGGACCTGGTGGG + Intronic
1119773742 14:77236336-77236358 GGGTATGGGCAGACTGTGGTGGG + Intronic
1120324834 14:83010412-83010434 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1120410910 14:84154197-84154219 TGCTGTGGGAAGGACCTGGTGGG + Intergenic
1120559983 14:85979487-85979509 TGTCATGGGCGGGATCTGGTGGG - Intergenic
1120628279 14:86856664-86856686 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1120831956 14:89005342-89005364 TGTTCTGGGAGGGATCTGGTGGG - Intergenic
1121063584 14:90939742-90939764 TGTTGTGGGAAGGACCTGGTGGG - Intronic
1121302891 14:92885949-92885971 TGGTAGGGGCAGGATAGGGGTGG + Intergenic
1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG + Intergenic
1122026145 14:98878856-98878878 TGTTATGGGAGGGATCTGGTGGG - Intergenic
1122269024 14:100560075-100560097 TGGTGTGGGCAGGAGAGGGTGGG + Intronic
1122685417 14:103502503-103502525 TGGGGTGGGCAGGAGCTGGCTGG + Intronic
1122960801 14:105092942-105092964 TGGGATTGCCAGGGTCTGGTGGG + Intergenic
1122988951 14:105227546-105227568 AGGTCCGGGCAGGATCGGGTAGG - Intronic
1125347448 15:38732471-38732493 AGGTATAGGCAGGATTTAGTGGG + Intergenic
1126677367 15:51171956-51171978 TGGTTTGGGTAAGATCTAGTAGG + Intergenic
1126731422 15:51687052-51687074 TTGTCTGGGCAGAATCTGGCCGG + Intronic
1127101606 15:55571458-55571480 TGTTGTGGGAGGGATCTGGTAGG + Intronic
1127955062 15:63846110-63846132 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1128733404 15:70035566-70035588 TCGTATGGGCAGGAACTGAGGGG - Intergenic
1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG + Intergenic
1131659370 15:94497774-94497796 TGCTGTGGGAAGGACCTGGTGGG + Intergenic
1131793942 15:95994211-95994233 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1132122926 15:99193346-99193368 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1133132649 16:3687125-3687147 TGTTGTGGGAAGGACCTGGTGGG + Intronic
1133261547 16:4554115-4554137 AGGTATGGTCAGGCTCTGCTTGG - Intergenic
1133731896 16:8585221-8585243 TGTTGTGGGAGGGATCTGGTGGG - Intronic
1133894138 16:9909273-9909295 TGTTGTGGGAAGGACCTGGTGGG - Intronic
1134277875 16:12792635-12792657 TGTCATGGGAAGGACCTGGTGGG + Intronic
1134327354 16:13219235-13219257 TGGAATGAACAGGATCTGGCTGG - Intronic
1134334347 16:13283637-13283659 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1134380663 16:13721864-13721886 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1134630313 16:15751521-15751543 TGGCATGTGCAGGACCTGCTGGG - Intronic
1134755135 16:16660348-16660370 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1134990928 16:18698825-18698847 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1135273950 16:21094773-21094795 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1135862308 16:26067744-26067766 TGTCATGGGGAGGAGCTGGTGGG + Intronic
1135993555 16:27231932-27231954 TGGTGAGTGCAGGATCTGCTGGG - Intronic
1136385203 16:29920956-29920978 TTGTAGGGGCAGGAACTGGAAGG + Intronic
1137323553 16:47410989-47411011 TGCTGTGGGCATGCTCTGGTGGG - Intronic
1137486635 16:48896541-48896563 TGGTATCTGCAGGAGCTGGAAGG - Intergenic
1137735798 16:50722226-50722248 TGTTATGGGCAGGTACTGGAGGG + Intronic
1137818439 16:51421517-51421539 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1138299135 16:55911857-55911879 GGGTCTGGGCAGGAGCTGTTTGG - Intronic
1138393870 16:56689803-56689825 TGGTAGGGCCAGCATCTGTTTGG - Intronic
1138736901 16:59261203-59261225 TGTTGTGGGAAGAATCTGGTGGG - Intergenic
1138811646 16:60157931-60157953 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1139531061 16:67542961-67542983 TGGAATGGGCAGGACTTGGGTGG - Exonic
1140626383 16:76799768-76799790 TGGTATGGGCAGGGTCTTTCAGG + Intergenic
1140666601 16:77233806-77233828 TGGTGTGCGCAGGATGTGGGTGG - Intergenic
1141803087 16:86324132-86324154 TGGGAAGGGCAGGAGCTGCTGGG - Intergenic
1144736541 17:17558825-17558847 TGGTGGGGGCAGGCTCTGGGAGG - Intronic
1146920172 17:36704774-36704796 TGGAATGAGCAGGGTCTGGTTGG - Intergenic
1148069989 17:44903119-44903141 TGGTATAGCCAGCATTTGGTTGG - Exonic
1148228076 17:45913360-45913382 TGTTGTGGGAGGGATCTGGTGGG - Intronic
1149302136 17:55315309-55315331 TGGAAAGGGCAAGATCTGCTGGG - Exonic
1149956370 17:61055178-61055200 TGATATTGGCAGGAGCTTGTGGG + Intronic
1150307087 17:64094768-64094790 TGGAATGGGCAGTACCAGGTTGG - Intronic
1150345188 17:64399216-64399238 TGGTGAGGGCAGCATATGGTGGG - Intronic
1150461766 17:65359566-65359588 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1150732115 17:67704677-67704699 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1151459699 17:74247276-74247298 TGTTATGGGAGGGACCTGGTGGG - Intronic
1152390571 17:80001626-80001648 TGGGATGGCCAGGAGCTGGGAGG - Intronic
1153214965 18:2810928-2810950 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1153506474 18:5804264-5804286 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1154134874 18:11767778-11767800 TGGTAAGAGCAAGACCTGGTGGG - Intronic
1154474006 18:14734601-14734623 TGTTGTGGACAGGACCTGGTGGG + Intronic
1155439517 18:25847275-25847297 TGGTATGGGCAGGAGCACATGGG - Intergenic
1155681474 18:28491994-28492016 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1156333144 18:36144477-36144499 TGTCAAGGGAAGGATCTGGTGGG - Intronic
1156530718 18:37812435-37812457 TGTCATGGGTGGGATCTGGTGGG + Intergenic
1157483471 18:48070789-48070811 TGGGAAGGGCAGGATGGGGTGGG - Intronic
1157960108 18:52143977-52143999 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1158166405 18:54546233-54546255 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1158313362 18:56183417-56183439 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1158764817 18:60437306-60437328 GGGTATAGACAGGATCTGGAGGG - Intergenic
1158766673 18:60458626-60458648 AGGTATGGCAAAGATCTGGTAGG + Intergenic
1159152174 18:64534731-64534753 TGTTGTGGGAAGGACCTGGTTGG + Intergenic
1159282798 18:66309673-66309695 TGTTGTGGGAAGGATCTGGTGGG - Intergenic
1159667871 18:71185604-71185626 TGGTATGGGCAGGGTCTGGGTGG + Intergenic
1159760626 18:72420756-72420778 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1159768114 18:72515114-72515136 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1159769184 18:72528146-72528168 TGCAATGGGAGGGATCTGGTGGG - Intergenic
1159920089 18:74220090-74220112 TGGTAGGGAGAGGACCTGGTTGG + Intergenic
1160081888 18:75735815-75735837 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1160979370 19:1809900-1809922 AACTATGGGCAGGGTCTGGTAGG - Intronic
1163418712 19:17202408-17202430 TGGTATGGGCAGGGCATGGGTGG - Intronic
1163728967 19:18938992-18939014 TGGGATGGGCAGGCTCTAGGGGG + Exonic
1164393823 19:27846898-27846920 TGGGAGGGGAAGGGTCTGGTCGG + Intergenic
1164439943 19:28268523-28268545 TCTTATTGGCAGCATCTGGTTGG + Intergenic
1166370905 19:42300302-42300324 TGGTGTGGGCAAGAAGTGGTAGG + Intronic
1166584052 19:43929706-43929728 TGTTATGTGGAGGACCTGGTGGG - Intronic
1166917956 19:46208605-46208627 TGTCAGGGGAAGGATCTGGTAGG + Intergenic
1167006150 19:46777670-46777692 TGGTATGGGCGGGATCTGGGTGG - Intronic
1167006164 19:46777713-46777735 TGGTATGGGCAGGATCTGGTGGG - Intronic
1167879510 19:52444521-52444543 TAGTATGGGGAGGATTAGGTGGG + Intronic
925108696 2:1314947-1314969 TGTTATGGGAGGGACCTGGTGGG - Intronic
925250208 2:2427693-2427715 TGTTGTGGGAAGGACCTGGTAGG - Intergenic
925596179 2:5557853-5557875 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
926431191 2:12787111-12787133 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
926459526 2:13111474-13111496 TGTCATGGGAGGGATCTGGTGGG + Intergenic
927237212 2:20885206-20885228 TGTCATGGGAAGGACCTGGTGGG + Intergenic
927602176 2:24453404-24453426 TGGTATGGGATGGAACAGGTAGG + Intergenic
930444161 2:51449991-51450013 TGTTATGGGAGGGACCTGGTGGG + Intergenic
930698879 2:54439512-54439534 TGATGTGGCCAGGATCAGGTGGG + Intergenic
930902375 2:56522990-56523012 TGGCCTGGGCAGGAGCTGGAAGG + Intergenic
931013697 2:57949936-57949958 TGGTAAGGGAAGGTTGTGGTTGG - Intronic
931522986 2:63119729-63119751 TGGTATAGGCAGGAACAGCTAGG - Intergenic
931668190 2:64625003-64625025 TGGCATGGGCAGGGGCTGCTTGG - Intergenic
932885075 2:75541988-75542010 TGTTATGGGAGGGACCTGGTGGG + Intronic
933268276 2:80205052-80205074 TGTTATGGGAGGGACCTGGTGGG - Intronic
933606817 2:84391896-84391918 TGTTATGGGAAGGACCAGGTGGG + Intergenic
933938455 2:87225872-87225894 TGGTTGGGGCTGGGTCTGGTGGG - Intergenic
935518135 2:104069000-104069022 TGTTATGGGAAGGATCCAGTGGG - Intergenic
935807148 2:106760382-106760404 TGTCAAGGGCAGGACCTGGTAGG + Intergenic
936354683 2:111739902-111739924 TGGTTGGGGCTGGGTCTGGTGGG + Intergenic
936846742 2:116843538-116843560 TGGTGTGGGAGGGATCTGGTGGG - Intergenic
937518889 2:122686748-122686770 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
937763046 2:125628345-125628367 TGTTATGAGAGGGATCTGGTGGG + Intergenic
938564526 2:132506737-132506759 TGTCATGGGAGGGATCTGGTGGG - Intronic
940296829 2:152135115-152135137 TGGTGTGGGGAGGTTGTGGTTGG - Intronic
940437216 2:153669195-153669217 TGGTATGGGGAGGCTGTGGTTGG - Intergenic
941319776 2:164040650-164040672 TGTTATGGGATGGACCTGGTGGG - Intergenic
941698145 2:168575515-168575537 TGTTAAGGGAGGGATCTGGTGGG - Intronic
942950222 2:181713053-181713075 TGGGAGGGGAAGGACCTGGTGGG + Intergenic
943438044 2:187891851-187891873 TGTTGTGGGAAGGATCTGGTGGG + Intergenic
943455814 2:188105155-188105177 TGTCATGGGCGGGACCTGGTGGG - Intergenic
943642687 2:190376395-190376417 TGGGATGTGCAGGATGGGGTGGG - Intergenic
943841662 2:192591095-192591117 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
944156296 2:196610986-196611008 CGTTGTGGGAAGGATCTGGTGGG - Intergenic
945842995 2:214910617-214910639 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
946584198 2:221165792-221165814 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
947255625 2:228160604-228160626 TGTCATGGGAGGGATCTGGTGGG - Intronic
947740517 2:232482786-232482808 GGGAAAGGGCAGGAGCTGGTAGG - Intronic
947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG + Intronic
948145350 2:235704113-235704135 TGGGATGGGCAGGGCCAGGTGGG + Intronic
948758405 2:240173165-240173187 TGTGATGGGCGGGAGCTGGTGGG - Intergenic
1169562591 20:6818068-6818090 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1169730201 20:8778013-8778035 TGTTGTGGGCGGGACCTGGTGGG - Intronic
1170499773 20:16962405-16962427 TGTTTTGGGAAGGACCTGGTGGG - Intergenic
1170736008 20:19014837-19014859 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1172477939 20:35252845-35252867 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172477953 20:35252883-35252905 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172477968 20:35252921-35252943 CGGCATGGGCAGGCTCAGGTGGG + Intronic
1172477982 20:35252959-35252981 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172477996 20:35252997-35253019 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172478010 20:35253035-35253057 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172478024 20:35253073-35253095 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172478039 20:35253111-35253133 AGGCATGGGCAGGCTCGGGTGGG + Intronic
1173138245 20:40459176-40459198 TGGTTTAGGCTGGATCTTGTTGG - Intergenic
1173281047 20:41628129-41628151 TGTTAGGGGAAGGACCTGGTGGG - Intergenic
1173460573 20:43240008-43240030 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1174688850 20:52482600-52482622 TGTTGTGGGCAGGACCTGGTGGG - Intergenic
1174956633 20:55105415-55105437 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1175376342 20:58527318-58527340 TGTCATGGGAGGGATCTGGTGGG - Intergenic
1175699492 20:61126718-61126740 TGCTCTGGGCAGGACCTGGAGGG + Intergenic
1176162336 20:63654031-63654053 GGGGATGGGCAGGATCTGAGCGG + Intergenic
1176695857 21:9977406-9977428 TGTTATGGGAAGGATCCAGTGGG + Intergenic
1177233320 21:18351432-18351454 TGCTGAGGGCAGGACCTGGTGGG + Intronic
1177275671 21:18910120-18910142 TGTCAAGGGAAGGATCTGGTGGG + Intergenic
1177728725 21:25000428-25000450 TGTTATGGGAGGGACCTGGTAGG + Intergenic
1178013835 21:28318705-28318727 TGTCAAGGGCAGGACCTGGTAGG + Intergenic
1178747301 21:35265388-35265410 CAGCATGGGCAGGATCTGGTGGG - Intronic
1179267502 21:39817221-39817243 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1179271835 21:39857624-39857646 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1179323908 21:40320807-40320829 TGTTGTGGGAGGGATCTGGTGGG - Intronic
1179331917 21:40411922-40411944 TGTTGTGGGAAGGACCTGGTGGG + Intronic
1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG + Intergenic
1179678060 21:42998321-42998343 TGTTATGGGAGGGAGCTGGTGGG - Intronic
1180254682 21:46617348-46617370 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1180319326 22:11306227-11306249 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1181094686 22:20496944-20496966 TGGTAGGGGGAGGATGTGGCTGG + Intronic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1181607907 22:23991576-23991598 AGGGATGGGCAGGAACTGCTGGG + Intergenic
1181880050 22:25971621-25971643 TGGTGTGGGAAGGCACTGGTAGG - Intronic
1182811645 22:33121975-33121997 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1183213303 22:36464089-36464111 TGGTAGGGGCAGGCACTGCTCGG + Intergenic
1184417514 22:44360873-44360895 TGGTATGGGCTGGAGCCGGCTGG + Intergenic
1184534351 22:45076589-45076611 TGGAATGGGCAGGGCCTGCTTGG - Intergenic
949636096 3:5982792-5982814 TGTTATGGGAGGGACCTGGTGGG - Intergenic
950178908 3:10897146-10897168 TGTTATAGGAGGGATCTGGTGGG - Intronic
950485828 3:13273594-13273616 TGGGATGGGCAGGAGCACGTGGG - Intergenic
950659072 3:14455498-14455520 TGGGATGTCCAGGGTCTGGTGGG + Intronic
951049977 3:18083490-18083512 TGTTGTGGGAGGGATCTGGTGGG - Intronic
952096652 3:29961785-29961807 TGTTGTGGGAAGGACCTGGTGGG - Intronic
952145625 3:30528839-30528861 TGAGATGGGAAGGATCTGGGTGG - Intergenic
952992549 3:38844362-38844384 AGGTAGGGGGAGGATCTGGAAGG - Intergenic
953827661 3:46267983-46268005 TGGCATGGGCAGGGTAGGGTGGG + Intergenic
954380260 3:50215478-50215500 TGGAATGGGCGGGAGCTGGTGGG + Intronic
954900112 3:54011952-54011974 TGTTATGGGAGGGATCCGGTGGG + Intergenic
954914701 3:54138944-54138966 TTGTTTGGGCAGGATGTGGTTGG + Intronic
955435626 3:58895982-58896004 TGTTGTGGGATGGATCTGGTAGG - Intronic
956203426 3:66731192-66731214 TGTTATGGGAGGGACCTGGTGGG + Intergenic
956713765 3:72060701-72060723 TGGTGTGGGAGGGATCTGGTGGG - Intergenic
956714045 3:72062882-72062904 TGTTATGGGAGGGACCTGGTGGG - Intergenic
956875560 3:73459242-73459264 TGTTATGGGAGGGACCTGGTGGG - Intronic
956916051 3:73872119-73872141 TGTTGAGGGAAGGATCTGGTGGG + Intergenic
957134855 3:76273761-76273783 TGTCATGGGAGGGATCTGGTGGG - Intronic
957337768 3:78853959-78853981 TGTTGTGGGAAGGATCTGGTGGG - Intronic
957520648 3:81314115-81314137 TGCTATGGGAGGGACCTGGTGGG - Intergenic
959104469 3:102050585-102050607 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
959364200 3:105436140-105436162 TGTTGTGGGAAGGACCTGGTGGG - Intronic
959380929 3:105640890-105640912 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
960061165 3:113323091-113323113 ATGTATGGGAGGGATCTGGTTGG - Intronic
960522937 3:118676867-118676889 TGGGATAGACAGGAGCTGGTGGG + Intergenic
961505905 3:127370343-127370365 AGGTCTGAGCAGGGTCTGGTGGG - Intergenic
962261406 3:133910856-133910878 TGTTATGGGAGGGACCTGGTGGG + Intergenic
962749815 3:138425548-138425570 TGGTTTGGGTAGGATTTGGCTGG + Intergenic
963513274 3:146275934-146275956 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
963516713 3:146317841-146317863 TGTCATGGGAGGGATCTGGTGGG - Intergenic
963786006 3:149535067-149535089 TGGTGAGGGCAGGAGCTGGCTGG - Intronic
963898096 3:150707087-150707109 TGTTGAGGGCAGGACCTGGTGGG - Intergenic
963941386 3:151099084-151099106 TGTTATGGGAGGGACCTGGTGGG - Intronic
964266179 3:154898091-154898113 TGTTGTGGGAAGGATCTGGTGGG - Intergenic
964520888 3:157564914-157564936 TGTTGTGGGAAGGACCTGGTGGG - Intronic
964560509 3:157990327-157990349 TGTTATGGGAGGGGTCTGGTGGG + Intergenic
965190805 3:165526612-165526634 TGTCATGGGAGGGATCTGGTGGG - Intergenic
965864186 3:173184097-173184119 TGTTATGGGAGGGACCTGGTGGG + Intergenic
966100244 3:176260074-176260096 TGTCATGGGAGGGATCTGGTGGG + Intergenic
966270228 3:178096201-178096223 TGTTATGGGAGGGAACTGGTGGG + Intergenic
966345456 3:178974239-178974261 TGTTGTGGGAAGGACCTGGTAGG + Intergenic
967003418 3:185359321-185359343 TGTTGTGGGAGGGATCTGGTGGG - Intronic
967255631 3:187589206-187589228 TGTTGAGGGCAGGACCTGGTGGG - Intergenic
969190185 4:5512282-5512304 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
969618825 4:8268825-8268847 TGTTAATGGCAGGTTCTGGTCGG - Intergenic
970310448 4:14777187-14777209 TGATATGGGAGGGACCTGGTGGG + Intergenic
970744685 4:19280916-19280938 TGTTAGGGGAAGGACCTGGTGGG - Intergenic
970752770 4:19384766-19384788 TGTTGTGGGAAGGATCCGGTGGG - Intergenic
970815419 4:20150585-20150607 TGTCATGGGAGGGATCTGGTAGG - Intergenic
971015998 4:22489280-22489302 TGTTATGGGAGGGACCTGGTGGG - Intronic
971064901 4:23020555-23020577 TGCTGTGGGAGGGATCTGGTGGG + Intergenic
971278601 4:25221947-25221969 TGTCATGGGAGGGATCTGGTGGG - Intronic
971687594 4:29788622-29788644 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
972037131 4:34539126-34539148 TGTCATGGGAGGGATCTGGTGGG + Intergenic
972193728 4:36627040-36627062 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
972242495 4:37208420-37208442 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
972301373 4:37788276-37788298 TGTTATGGGAGGGACCTGGTGGG + Intergenic
973007856 4:45035081-45035103 TGTTATGGGAGGGACCTGGTGGG + Intergenic
973209788 4:47603092-47603114 TGTAATGGGAGGGATCTGGTGGG + Intronic
973831533 4:54764679-54764701 TAGTATGGGCAGGAACAGGTGGG + Intergenic
974177773 4:58345732-58345754 GGGTTTAGGCAGGACCTGGTGGG + Intergenic
974754536 4:66186661-66186683 TCTTATGGGCAGGATATAGTTGG + Intergenic
975027277 4:69566546-69566568 TGTTATGGGAGGGACCTGGTGGG + Intergenic
975037071 4:69697254-69697276 TGTTGAGGGCAGGACCTGGTGGG + Intergenic
976726478 4:88220716-88220738 TGTCATGGGAAGGACCTGGTGGG + Intronic
976926355 4:90502412-90502434 TGTTAAGGGAAGGACCTGGTGGG - Intronic
976939684 4:90684713-90684735 TGTTGTGGGAAGGACCTGGTGGG + Intronic
976987162 4:91315946-91315968 TGTCATGGGAAGGAGCTGGTGGG + Intronic
977076887 4:92464860-92464882 TGTTAGGGGAAGGACCTGGTGGG + Intronic
977093775 4:92713824-92713846 TGTTATGGGAGGGACCTGGTGGG - Intronic
977197743 4:94083336-94083358 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
978201718 4:106029768-106029790 TGTTATGGGAGGGACCTGGTGGG + Intergenic
978639660 4:110855101-110855123 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
978769703 4:112442186-112442208 TGTCATGGGAAGGACCTGGTAGG - Exonic
979426557 4:120573717-120573739 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
981228535 4:142325188-142325210 CGGTTTGGGTAGGATGTGGTAGG - Intronic
981426496 4:144609397-144609419 TGGTGAGGGCAGCATCTTGTAGG - Intergenic
981695361 4:147553748-147553770 TGTCGTGGGCAGGACCTGGTGGG + Intergenic
982132819 4:152245875-152245897 GGCTGTGGGGAGGATCTGGTGGG - Intergenic
982276279 4:153639846-153639868 TCTTATGGTTAGGATCTGGTGGG + Intergenic
982618786 4:157677744-157677766 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
983010063 4:162536668-162536690 GGTTATGGGCAGCATCTTGTTGG + Intergenic
983095049 4:163551689-163551711 TGTTATGAGAAGGACCTGGTAGG + Intronic
983416364 4:167460287-167460309 TAGTATGGGAAGGTCCTGGTGGG - Intergenic
983860210 4:172696514-172696536 TGTCATGGGAGGGATCTGGTGGG + Intronic
984080984 4:175250079-175250101 TGTTATGGGAGGGACCTGGTGGG - Intergenic
984234584 4:177141121-177141143 TGTTATGGGAGGGACCTGGTGGG + Intergenic
985304037 4:188519967-188519989 TGTTGTGGGCAGGACCCGGTGGG + Intergenic
986008310 5:3686623-3686645 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
986069724 5:4270094-4270116 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
986221933 5:5775974-5775996 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
986668239 5:10121358-10121380 TGTTATGGGAGGGAACTGGTGGG + Intergenic
986680233 5:10225695-10225717 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
986785930 5:11113795-11113817 TGGAATGGGCAGGGGCTGCTGGG + Intronic
986967034 5:13286410-13286432 TGTCATGGGAAGGACCTGGTGGG + Intergenic
987172192 5:15270427-15270449 TGTCATGGGAGGGATCTGGTGGG + Intergenic
987192263 5:15490391-15490413 TTGAATGGGCAGGCTCTGTTCGG - Intergenic
987593405 5:19963440-19963462 TGTCATGGGAGGGATCTGGTGGG + Intronic
987659687 5:20855788-20855810 TGTCATGGGAGGGATCTGGTGGG + Intergenic
987799373 5:22674216-22674238 TGTTGTGGGAGGGATCTGGTGGG + Intronic
988012327 5:25505419-25505441 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
988327438 5:29788088-29788110 TGGTGTGGGAGGGACCTGGTGGG + Intergenic
988344640 5:30021244-30021266 TAGTATGGAGAGGAACTGGTAGG - Intergenic
988763957 5:34349859-34349881 TGTCATGGGAGGGATCTGGTGGG - Intergenic
988924748 5:35978609-35978631 TGTTATGGGAGGGACCTGGTGGG - Intronic
989088758 5:37706421-37706443 TGTTGTGGGAAGGACCTGGTGGG + Intronic
989740741 5:44768110-44768132 TGTTGTGGGAAGGACCTGGTAGG - Intergenic
989954555 5:50342162-50342184 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
990458703 5:56013809-56013831 TGCTGTGGGAAGGATCTGGTGGG + Intergenic
991439069 5:66627303-66627325 TGTCATGGGAAGGACCTGGTGGG - Intronic
991636034 5:68706904-68706926 TGTTAAGGGCAGGATCTTGTGGG - Intergenic
993036729 5:82767401-82767423 TGTCATGGGAGGGATCTGGTGGG + Intergenic
993070741 5:83160391-83160413 TTGTATGTGCAGTATCTGTTTGG + Intronic
993680957 5:90877194-90877216 AGGAATGGGCAGTATCTGGCAGG + Intronic
995113652 5:108454755-108454777 TGTTATGGGAGGGATCTTGTGGG + Intergenic
995944026 5:117620504-117620526 TGTTGTGGGAGGGATCTGGTAGG + Intergenic
996172842 5:120316188-120316210 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
996352267 5:122557773-122557795 TGTTGTGAGCAGAATCTGGTGGG - Intergenic
997527033 5:134560082-134560104 TGGTATGGCATGGATCTGGAGGG + Intronic
997613178 5:135229347-135229369 GCGTATGGGCAGGACCTGGAAGG + Intronic
997695749 5:135859410-135859432 TGTCATGGGAGGGATCTGGTAGG - Intronic
998569582 5:143245150-143245172 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
998684138 5:144505051-144505073 TGGTAGGAGGAGGAGCTGGTGGG - Intergenic
999146454 5:149399114-149399136 TGTTGTGGGAAGGACCTGGTGGG - Intronic
999473551 5:151877615-151877637 TGTTATGGGAGGGACCTGGTGGG + Intronic
1000334131 5:160229370-160229392 TGATGTGGGCAGGACCTGGAGGG - Intronic
1000581162 5:163036416-163036438 TGTCTTGGGAAGGATCTGGTGGG + Intergenic
1001126493 5:169024279-169024301 TGTTATGTGCATGACCTGGTAGG + Intronic
1001352399 5:170981417-170981439 TGTTGTGGGAGGGATCTGGTGGG + Intronic
1001922762 5:175613417-175613439 TGGTGTGGGAGGGACCTGGTGGG - Intergenic
1002013186 5:176301173-176301195 TGTTATGGGAGGGACCTGGTGGG + Intronic
1002214654 5:177621573-177621595 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1002327860 5:178421316-178421338 TAGTAAGGGCGGGTTCTGGTTGG - Intronic
1002905154 6:1442410-1442432 TGTTATTGGAGGGATCTGGTAGG - Intergenic
1003564817 6:7214143-7214165 TGGGATGGGTAGGATTTGGTGGG + Intronic
1003945566 6:11072288-11072310 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1004403791 6:15312868-15312890 AGGTAAGGGCAGAATCTGGCTGG - Intronic
1004609356 6:17224700-17224722 TGTTGTGGGCCGGACCTGGTGGG - Intergenic
1004805594 6:19200989-19201011 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1004921414 6:20379476-20379498 TGGAATGGGGAGGGTGTGGTTGG + Intergenic
1005888889 6:30120132-30120154 AGGCATGAGGAGGATCTGGTTGG + Intergenic
1008587696 6:52964127-52964149 TGGTCTTGGCAGCATCAGGTAGG + Intergenic
1008707987 6:54186746-54186768 TGTTGAGGGCAGGAACTGGTGGG - Intronic
1008751577 6:54739949-54739971 TGTCATGGGCAGGACCTGGTAGG + Intergenic
1009058786 6:58372322-58372344 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1009232059 6:61074795-61074817 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1009316233 6:62224328-62224350 TGTTTTGGGAGGGATCTGGTGGG - Intronic
1010261337 6:73820654-73820676 TGGCGAGGGCAGGATTTGGTAGG + Intronic
1010480341 6:76344519-76344541 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1010655483 6:78506654-78506676 TGTTGTGGGAAGGACCTGGTAGG + Intergenic
1011152710 6:84291530-84291552 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1011461821 6:87613361-87613383 TGCTATGGGAGGGACCTGGTGGG - Intronic
1012005290 6:93706589-93706611 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1012154740 6:95804189-95804211 TGATAAGGGCAGGATGTTGTTGG + Intergenic
1012224268 6:96686773-96686795 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1012445076 6:99298904-99298926 GGGGATGGGGAGTATCTGGTAGG - Intronic
1012867308 6:104633626-104633648 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1013014964 6:106152581-106152603 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1013342650 6:109230170-109230192 TGGCATGTTCAGGATCTGCTGGG + Intergenic
1013401037 6:109796317-109796339 TGGAAAGGGCAGGATCAGGCTGG - Intronic
1013845668 6:114447936-114447958 TGGCAGGGGCAGAACCTGGTGGG - Intergenic
1013962525 6:115917647-115917669 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1014901392 6:126969955-126969977 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1015182711 6:130378165-130378187 TTGTATGGGAAGTATCTGCTAGG + Intronic
1015846531 6:137525924-137525946 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1016085349 6:139906690-139906712 TGGCATGGGAGGGACCTGGTCGG - Intergenic
1016129895 6:140454794-140454816 TGGTATGGGTAGGCTGAGGTGGG - Intergenic
1016253270 6:142072294-142072316 TGGTATCGGCATGACCTGGATGG + Intronic
1016566746 6:145463922-145463944 TGGCAGGGGAAGGACCTGGTGGG + Intergenic
1017461106 6:154651414-154651436 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1017611800 6:156194718-156194740 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1017619183 6:156277771-156277793 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1019013314 6:168860829-168860851 TGGTTGGGGCAGGGTCAGGTGGG + Intergenic
1019199468 6:170302353-170302375 TGTCATGGGAAGGACCTGGTGGG - Intronic
1019703698 7:2487596-2487618 TGGTGTGGGAAGGAGCTGGTCGG + Intergenic
1019892389 7:3956656-3956678 TGGCATGGGCAAGGTCTGGGGGG - Intronic
1020471243 7:8537573-8537595 TGTCATGGGAAGGACCTGGTGGG - Intronic
1020720346 7:11736852-11736874 TGTCATAGGAAGGATCTGGTGGG + Intronic
1020936736 7:14474154-14474176 TGTTGTGGGAAGGACCTGGTGGG + Intronic
1021036987 7:15811173-15811195 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1022211190 7:28211259-28211281 TGTCATGGGCAGGACCTGGTGGG - Intergenic
1022706140 7:32803689-32803711 TGTTAAGGGAGGGATCTGGTGGG - Intergenic
1022865883 7:34419585-34419607 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1022964400 7:35459101-35459123 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1023682037 7:42696988-42697010 TGGCATGGGGAAGGTCTGGTGGG + Intergenic
1024158433 7:46649492-46649514 TGTTGTGGGAAGGATCTTGTGGG - Intergenic
1024169100 7:46765857-46765879 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1024389062 7:48786425-48786447 TGTTTTGGGAAGGACCTGGTGGG + Intergenic
1024431715 7:49295852-49295874 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1024577040 7:50773222-50773244 TGCTATGGGAGGGACCTGGTGGG - Intronic
1025625330 7:63216232-63216254 TGTTAGAGGCAGGGTCTGGTGGG + Intergenic
1026020237 7:66700143-66700165 TGGAATGTGCAGGGTCTGGCTGG - Intronic
1026326652 7:69316248-69316270 TGTCAAGGGCAGGACCTGGTGGG + Intergenic
1026510946 7:71027067-71027089 TGGAATGTGCAGGACGTGGTTGG - Intergenic
1026880080 7:73902269-73902291 TGGAATGTGCAGGGTCTGGCTGG + Intergenic
1026982964 7:74537547-74537569 TGCTGGGGGCAGGGTCTGGTGGG - Intronic
1027214083 7:76173150-76173172 TGCTGGGGGCAGGGTCTGGTGGG - Intergenic
1027401877 7:77817605-77817627 TGTCATGGGAAGGACCTGGTGGG - Intronic
1027733516 7:81904674-81904696 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1028323684 7:89495306-89495328 TGTTGGGGGAAGGATCTGGTGGG - Intergenic
1028404996 7:90465179-90465201 TGTCATGGGAAGGACCTGGTGGG + Intronic
1030187362 7:106777214-106777236 TGTTGTGGGACGGATCTGGTGGG - Intergenic
1031193529 7:118585657-118585679 TGTTATGGGAGGGACCTGGTAGG + Intergenic
1031215022 7:118879427-118879449 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1031446540 7:121861867-121861889 TGATGTGGGAAGGACCTGGTGGG - Intergenic
1031679109 7:124649226-124649248 TGGAAGGGGCAGGCTCTGGAGGG - Intergenic
1031792109 7:126118928-126118950 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1033707576 7:143903939-143903961 TGTTATGGGAGGGATCTGGTGGG - Intergenic
1033975672 7:147097623-147097645 TGTTGTGGGAGGGATCTGGTGGG - Intronic
1034384608 7:150729746-150729768 TGTTAGAGGCAGGACCTGGTGGG + Intronic
1034679935 7:152920917-152920939 TGGTGTGGGAGGGACCTGGTGGG - Intergenic
1036076366 8:5506221-5506243 TCCTATGGGGAAGATCTGGTGGG + Intergenic
1036798792 8:11774470-11774492 TGTTATGGGACGGACCTGGTGGG - Intronic
1036981342 8:13473272-13473294 TGTTGTGGGAAGGACCTGGTGGG + Intronic
1039021278 8:33209441-33209463 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1039028620 8:33285598-33285620 TGGTAAGGGAAGGATCAGGAAGG + Intergenic
1039064642 8:33598158-33598180 TGCTATGGGAAGGGTGTGGTGGG + Intronic
1039076540 8:33695104-33695126 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1039547224 8:38418898-38418920 TGTTATGGGAGGGACCTGGTAGG + Intronic
1040600970 8:48883492-48883514 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1040966178 8:53083018-53083040 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1043059971 8:75488042-75488064 TGTCATGGGAGGGATCTGGTGGG - Intronic
1043842016 8:85117739-85117761 TGTTAAGGGTAGAATCTGGTTGG - Intronic
1044003916 8:86918487-86918509 TGTTGTGGGGAGGACCTGGTGGG + Intronic
1044496311 8:92888742-92888764 GGTTGTGGGCAGGATCTGGTTGG + Intronic
1045416314 8:101971383-101971405 TGTCAAGGGCAGGACCTGGTGGG + Intronic
1046175457 8:110570296-110570318 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1046755926 8:117972896-117972918 TGTCATGGGAGGGATCTGGTGGG - Intronic
1046822386 8:118648545-118648567 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1046927192 8:119804440-119804462 TGGTATGGGAGGGACCTGGTAGG + Intronic
1047054216 8:121146154-121146176 TGTTGTGGGAAGGACCTGGTAGG + Intergenic
1047313227 8:123709667-123709689 TGGGATTGGGAAGATCTGGTAGG - Intronic
1047870078 8:129072329-129072351 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1048012624 8:130470359-130470381 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1048017728 8:130512499-130512521 TGTCAAGGGCAGGACCTGGTGGG + Intergenic
1049733244 8:144189845-144189867 TGGAGTGGGCAGGAACTTGTGGG + Intronic
1050634221 9:7593101-7593123 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1050940378 9:11450733-11450755 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1051488094 9:17630540-17630562 TGGGAAGGGCAGAATGTGGTAGG + Intronic
1052218209 9:25991499-25991521 TGTTGTGGGAGGGATCTGGTGGG - Intergenic
1052311723 9:27075330-27075352 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1053632840 9:39963361-39963383 TGTTATGGGAAGGATCCAGTGGG + Intergenic
1053772918 9:41500172-41500194 TGTTATGGGAAGGATCCAGTGGG - Intergenic
1053876653 9:42552417-42552439 TGGTGGGGGCAGGATGTGGGGGG + Intergenic
1054211048 9:62287336-62287358 TGTTATGGGAAGGATCCAGTGGG - Intergenic
1054235046 9:62549304-62549326 TGGTGGGGGCAGGATGTGGGGGG - Intergenic
1054313934 9:63561515-63561537 TGTTATGGGAAGGATCCAGTGGG + Intergenic
1055189364 9:73498615-73498637 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1056558266 9:87707375-87707397 TGGCTTGGGCAGGGTCTGTTTGG + Exonic
1057339678 9:94188809-94188831 TGGATGGGGCAGGAGCTGGTGGG - Intergenic
1057551582 9:96054604-96054626 TGTTATGGGAGGGATCCGGTGGG - Intergenic
1057739854 9:97701576-97701598 GGTTATGGGCAGCATCTTGTTGG - Intergenic
1057917885 9:99071683-99071705 TGGTATGGACAGGAACTGCAAGG + Intergenic
1058004728 9:99902987-99903009 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1058194822 9:101959469-101959491 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1061605173 9:131704581-131704603 TGGTATGGCCTGGAGCTGCTGGG + Intronic
1062386021 9:136311834-136311856 TGCTGTGGGCAGGATGGGGTGGG + Intergenic
1185974249 X:4701418-4701440 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1186039476 X:5460520-5460542 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1186468239 X:9801263-9801285 TGTTATGGGAGGGACCTGGTGGG - Intronic
1186954870 X:14670690-14670712 TGTTATGGGAGGGACCTGGTGGG - Intronic
1187700585 X:21961305-21961327 TGGTTGGGGTAGGCTCTGGTGGG + Intronic
1188753963 X:33937281-33937303 TGCTGTGGGAAGGAACTGGTGGG - Intergenic
1189403340 X:40693306-40693328 TGTTGTGGGAAGGACCTGGTAGG + Intronic
1190127974 X:47722917-47722939 TGGTCAGGGCAGGATCAGGAGGG - Intergenic
1191112139 X:56812257-56812279 TGGTTTGGGGAGGGTCGGGTGGG + Intergenic
1191923105 X:66278566-66278588 TGTTGAGGGCAGGACCTGGTGGG - Intergenic
1191923339 X:66280434-66280456 TGTTGAAGGCAGGATCTGGTGGG - Intergenic
1193631218 X:83890475-83890497 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1193686086 X:84579001-84579023 TGTAATGGGAAGGACCTGGTGGG + Intergenic
1193841910 X:86417625-86417647 TGATATGGGAGGAATCTGGTGGG - Intronic
1193907394 X:87260262-87260284 TGTAATGGGCAGGGTCTGGAGGG + Intergenic
1194142385 X:90221875-90221897 GGTTATGGGCAGCATCTTGTTGG + Intergenic
1194397417 X:93403299-93403321 TGTCATGGGAAGGACCTGGTAGG - Intergenic
1194665428 X:96672424-96672446 TGTTATGGGAGGGACCTGGTGGG - Intergenic
1194877097 X:99202047-99202069 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1195154653 X:102110677-102110699 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1195231944 X:102859267-102859289 TAGTATAGGGAGGATCAGGTGGG + Intergenic
1195816624 X:108895633-108895655 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1195986431 X:110635712-110635734 TGTCAAGGGCAGGACCTGGTGGG - Intergenic
1196243955 X:113376246-113376268 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1196326894 X:114416139-114416161 TGTTATGGGAAGGACCTGGTGGG + Intergenic
1196483752 X:116180652-116180674 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1196559432 X:117127429-117127451 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1197103804 X:122689089-122689111 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1197229953 X:123993011-123993033 TGGTTTTTGCAGGATCTTGTTGG + Intronic
1197476920 X:126936612-126936634 TGCTATGGGAGGGACCTGGTGGG - Intergenic
1199157772 X:144570902-144570924 TGTTGTGGGAAGGATCTGGTGGG + Intergenic
1199163129 X:144637937-144637959 TGTCATGGGAAGGACCTGGTAGG - Intergenic
1199279083 X:145978067-145978089 TGTTGTGGGAGGGATCTGGTGGG + Intergenic
1199569246 X:149251589-149251611 TGTTGTGGGAAGGACCTGGTGGG - Intergenic
1199993305 X:153002297-153002319 TGTTGTGGGAAGGACCTGGTGGG + Intergenic
1200488138 Y:3790976-3790998 GGTTATGGGCAGCATCTTGTTGG + Intergenic
1201210358 Y:11674896-11674918 TGGAATGGGCAGGATTTGAATGG + Intergenic
1201288074 Y:12395953-12395975 TGGTTTGGGTGGGATCTGGCCGG - Intergenic
1201448545 Y:14084281-14084303 TGTTATGGGAGGGACCTGGTGGG + Intergenic
1201733814 Y:17235559-17235581 TGTCATGGGAAGGACCTGGTTGG + Intergenic
1201923988 Y:19265333-19265355 TGTTGTGGGAAGGACCTGGTGGG - Intergenic