ID: 1167013521

View in Genome Browser
Species Human (GRCh38)
Location 19:46824541-46824563
Sequence GGTTGCAAACACATGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167013512_1167013521 29 Left 1167013512 19:46824489-46824511 CCTCAAAAGCCCAGAACTGACTC No data
Right 1167013521 19:46824541-46824563 GGTTGCAAACACATGGCCTGAGG No data
1167013516_1167013521 3 Left 1167013516 19:46824515-46824537 CCTGTGCTTTAGTGCAGTTGCAC No data
Right 1167013521 19:46824541-46824563 GGTTGCAAACACATGGCCTGAGG No data
1167013515_1167013521 19 Left 1167013515 19:46824499-46824521 CCAGAACTGACTCTGGCCTGTGC No data
Right 1167013521 19:46824541-46824563 GGTTGCAAACACATGGCCTGAGG No data
1167013514_1167013521 20 Left 1167013514 19:46824498-46824520 CCCAGAACTGACTCTGGCCTGTG No data
Right 1167013521 19:46824541-46824563 GGTTGCAAACACATGGCCTGAGG No data
1167013511_1167013521 30 Left 1167013511 19:46824488-46824510 CCCTCAAAAGCCCAGAACTGACT No data
Right 1167013521 19:46824541-46824563 GGTTGCAAACACATGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167013521 Original CRISPR GGTTGCAAACACATGGCCTG AGG Intergenic
No off target data available for this crispr