ID: 1167016482

View in Genome Browser
Species Human (GRCh38)
Location 19:46844267-46844289
Sequence CAGGGTAATCTCTTGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167016482_1167016487 11 Left 1167016482 19:46844267-46844289 CCCTGCACCAAGAGATTACCCTG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1167016487 19:46844301-46844323 CTTTCATCTCCTCCCCTTCCTGG 0: 1
1: 0
2: 4
3: 56
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167016482 Original CRISPR CAGGGTAATCTCTTGGTGCA GGG (reversed) Intronic
901542282 1:9926719-9926741 CAGGCTAATATTTTGGTGAAAGG - Intronic
901971787 1:12914122-12914144 CTGGGAAATGTCTCGGTGCAGGG - Intronic
902013381 1:13287618-13287640 CTGGGAAATGTCTCGGTGCAGGG + Intergenic
903744875 1:25580165-25580187 CAGGGTAGGCTCCTGGTGGATGG + Intergenic
903834241 1:26192495-26192517 CAGGATAATCGCTTGAAGCAGGG + Intronic
905073029 1:35244403-35244425 GAGGGTGCTCTCTTGGTTCATGG + Intergenic
906976275 1:50576652-50576674 CAAGATCATATCTTGGTGCAGGG - Intronic
907780547 1:57562278-57562300 CAGGGGAATCGCTTGGACCAGGG + Intronic
909119031 1:71576867-71576889 CAGGGTTATTTTTTGGTCCAAGG - Intronic
910692004 1:89974708-89974730 CAGGGTAATATATTAGTGAAAGG + Intergenic
912713641 1:111966848-111966870 AAGGGTAAACTCATGGGGCATGG + Intronic
913703800 1:121398046-121398068 CAGGGGGATCTTTTGGTGCAAGG - Intergenic
913980151 1:143499755-143499777 CAGGGGGATCTTTTGGTGCAAGG - Intergenic
914074499 1:144325240-144325262 CAGGGGGATCTTTTGGTGCAAGG - Intergenic
914104677 1:144641206-144641228 CAGGGGGATCTTTTGGTGCAAGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914788876 1:150858848-150858870 CAGGATGATCTCTTGGAGCTAGG - Intronic
915029346 1:152863137-152863159 CATGGTAATATCATAGTGCAAGG + Intergenic
918292026 1:183118037-183118059 AAGGGTAATCTGTTGCTTCATGG - Exonic
921128189 1:212196475-212196497 CAGGGGAATCACATGGTGAAAGG - Intergenic
921422720 1:214967066-214967088 CAGTGTCATCTCATGGTGGAAGG + Intergenic
921658337 1:217768150-217768172 CAGGGTAATCACTTGAACCAGGG + Intronic
924320386 1:242842811-242842833 CAGGACAATCTCTTCCTGCAAGG - Intergenic
1063838989 10:10048599-10048621 CAGGGGAATCTCTTGAAGCCGGG - Intergenic
1064083614 10:12328316-12328338 CAGGAGAATCACTTGGAGCAGGG - Intergenic
1065001667 10:21342869-21342891 CAGGGGAATCTCTTGAACCAGGG + Intergenic
1065163714 10:22952030-22952052 CAGGGGAATCTCTTGAACCAGGG + Intronic
1065693088 10:28355199-28355221 CAGGATAATCTCTTGAAGCCAGG - Intergenic
1066140831 10:32502188-32502210 CAGGAAATTCTCTTGGTGCCTGG - Intronic
1066953958 10:42148559-42148581 CCAGGGAATCTTTTGGTGCAAGG + Intergenic
1068110335 10:52672668-52672690 CAGGGTAATCACTTGAAGCTGGG + Intergenic
1071036654 10:81255635-81255657 GAGGGTCATCTCATGGTGGAAGG + Intergenic
1074192250 10:111148268-111148290 CAGGGTAATTGCTTTGTGCCAGG + Intergenic
1074192410 10:111149412-111149434 CAGGGTAATTGCTTTGTGCCAGG + Intergenic
1074210849 10:111333592-111333614 CATGGCAATCTCTAGCTGCAAGG - Intergenic
1075658483 10:124176978-124177000 CAGGAGCAGCTCTTGGTGCAGGG + Intergenic
1078478120 11:11651648-11651670 CCTGCTCATCTCTTGGTGCAAGG - Intergenic
1079781880 11:24617726-24617748 CAGGGTAATCTCTTGAACCTCGG + Intronic
1084466585 11:69326765-69326787 CGGGGTCATCTCTGGGGGCAGGG - Intronic
1085444134 11:76589470-76589492 CAGGGTTGGCTCTTGGTGCCAGG + Intergenic
1086863460 11:91952100-91952122 CAGGGTAATCTCTTGAACCTGGG - Intergenic
1088485924 11:110340387-110340409 CAGGGCCATCTCTAGATGCAAGG + Intergenic
1091272694 11:134328915-134328937 GAGGGTTATATCTTGGTCCAGGG + Intergenic
1091936457 12:4438666-4438688 CAGGGGAATCTCTTGGACCGGGG + Intronic
1095595256 12:43951149-43951171 CAAGGTAATCTCTTGATTCATGG - Intronic
1096300981 12:50427031-50427053 TAAGGTAATCTCTTGAGGCAGGG - Intronic
1097726627 12:63082502-63082524 CAGGGTAATCTCTTGAACCTGGG - Intergenic
1100558592 12:95723290-95723312 CTTGGTAATCTCTTGGTGGTGGG - Intronic
1107242950 13:38259476-38259498 CAGGAGAATCTCTTGAAGCAGGG + Intergenic
1113466194 13:110514851-110514873 CAGGCTAGTTTCTTGGTGCCAGG + Intergenic
1115189577 14:30732902-30732924 CAAGGTATTCTCTTGATGGAAGG + Intronic
1115365020 14:32548192-32548214 CAGGGTAATCTCTTGAACCTGGG - Intronic
1117964385 14:61191578-61191600 CAGGGGAATCTCTTGAAGCTGGG + Intronic
1119359317 14:74034860-74034882 CAGGATAATCTCTTGAGGCCAGG + Intronic
1119657187 14:76425540-76425562 CAGGGAAATCTGTTGCTGGAAGG - Intronic
1123393472 15:19900296-19900318 CAGGGGGATCTTTTGGTGCAAGG - Intergenic
1130413553 15:83668852-83668874 CTGGTTAGTCTCTTGGTCCAAGG - Intronic
1134156135 16:11844719-11844741 CTGGGGAATCTCTGGGTGGAAGG + Intronic
1136768179 16:32810264-32810286 CAGAGGGATCTTTTGGTGCAAGG + Intergenic
1136799964 16:33060841-33060863 CAGGGGGATCTTTTGGTGCACGG - Intergenic
1136957862 16:34804851-34804873 CAGGGGGATCTTTTGGTGCAAGG - Intergenic
1138127014 16:54447432-54447454 CAGGGTGATTTCGTGCTGCAGGG + Intergenic
1138443311 16:57047743-57047765 CAGGGGACTCTCATGGGGCAGGG - Intronic
1138640061 16:58378388-58378410 CAGGGTGATGTCATGGGGCAGGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140732849 16:77871988-77872010 CATGGTAAGCTCTGGGTCCATGG - Intronic
1141005141 16:80344885-80344907 CAGTGTAATCTCACTGTGCATGG - Intergenic
1203070571 16_KI270728v1_random:1072280-1072302 CAGGGGGATCTTTTGGTGCAAGG + Intergenic
1144792694 17:17869996-17870018 CAGGGAAATTTCTAGGTGAAAGG + Intronic
1145117709 17:20226975-20226997 CAGGCAGCTCTCTTGGTGCAGGG + Intronic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1154143146 18:11843430-11843452 CAGGATAATCACTTGAAGCAGGG + Intronic
1154518094 18:15196781-15196803 CAGGGGGATCTTTTGGTGCAAGG + Intergenic
1156048631 18:32905679-32905701 CACCGTAGTCTCTAGGTGCATGG + Intergenic
1157335585 18:46734822-46734844 CAGGGTGCTCTCTTGGGGTAGGG - Intronic
1162113953 19:8417035-8417057 CAGGTAAATCTCTTAATGCAAGG - Intronic
1162469264 19:10862600-10862622 CAGGCAGATCTCTTGGGGCAAGG + Intronic
1164719912 19:30424510-30424532 CAGGGGAATCTCTGGGTTCTGGG + Intronic
1165883986 19:39064035-39064057 CAGGAGAATCTCTTGATCCAGGG + Intergenic
1165988997 19:39795258-39795280 TAGGCTAACCTCTTGGTCCAGGG - Intergenic
1167016482 19:46844267-46844289 CAGGGTAATCTCTTGGTGCAGGG - Intronic
1202679994 1_KI270712v1_random:1715-1737 CAGGGGGATCTTTTGGTGCAAGG + Intergenic
925449213 2:3953770-3953792 CAGGGTCATACCTTGTTGCAGGG - Intergenic
925818478 2:7776611-7776633 CAGGGGAATCTCTTGAACCAGGG - Intergenic
927211593 2:20642256-20642278 CGGGGAGATCCCTTGGTGCAGGG + Intronic
927273288 2:21237942-21237964 AAGGGTAGTTTCTTGGTGTATGG + Intergenic
932206257 2:69885593-69885615 GAGGGTCATCTCATGGTGGAAGG - Intergenic
933157569 2:78992713-78992735 CAGGGTAGCCTCTTGGGGCTCGG - Intergenic
933648743 2:84832216-84832238 CAGGGTAATTTCTTGGTTCTAGG - Intronic
941790558 2:169547790-169547812 CAGGGGAATCTCTTGAACCAGGG + Intronic
941808850 2:169735799-169735821 CTGGGAAATCTCTTTATGCATGG - Exonic
946327296 2:218991332-218991354 CAGGGAACTGTCTTGGTGAATGG - Intronic
947533247 2:230925878-230925900 CAGGGAAATCTCTGCTTGCAGGG - Intronic
1172003041 20:31795558-31795580 CCGGGTGATCACTTGGAGCAGGG - Intronic
1172574796 20:36000467-36000489 CAGGGTAATCGCTTGAACCAGGG - Intronic
1173340746 20:42150495-42150517 CACTGTACTCTCCTGGTGCAGGG + Intronic
1174090069 20:48039659-48039681 CAGGCTAATATCTTGGGGAAAGG + Intergenic
1174647355 20:52097545-52097567 CAGGGTAATCTCTTGAACCCGGG - Intronic
1178488778 21:33034762-33034784 CAGTGAATTCTCTTAGTGCACGG - Intergenic
1178679434 21:34660134-34660156 CAGGGCAATCTCCAGGGGCAGGG - Intergenic
1180802040 22:18636523-18636545 CAGGGTCATCTGAGGGTGCAGGG + Intergenic
1180853277 22:19032075-19032097 CAGGGTCATCTGAGGGTGCAGGG + Intergenic
1181219682 22:21358736-21358758 CAGGGTCATCTGAGGGTGCAGGG - Intergenic
1184873920 22:47260540-47260562 CAGTCTAACCTCTTGGTTCAGGG - Intergenic
949777675 3:7650808-7650830 CAGGAGAATCTCTTGGAGCCAGG - Intronic
949912209 3:8921422-8921444 CAGGGGAATCTCTTGAGGCTAGG + Intronic
953962062 3:47273897-47273919 CCGGATCATCTCTTGGTGGAGGG - Intronic
954645538 3:52129435-52129457 CAGGGTATCCACTTGGGGCAGGG + Intronic
956758164 3:72410732-72410754 CAGTGTACTCTCTAGGTCCATGG + Intronic
959090301 3:101895518-101895540 AAGGGTCATCTCATGGTGAAAGG - Intergenic
961649214 3:128409079-128409101 CAGGGTGGTCTGTGGGTGCAGGG - Intergenic
964279569 3:155049273-155049295 AAGGGTACTCTCTTGGGACATGG - Intronic
966278729 3:178206049-178206071 CAGGGTAAACTCTTGCAGCAGGG - Intergenic
966687587 3:182712651-182712673 CAGGGGAATCACTTGGACCAGGG + Intergenic
970185419 4:13446503-13446525 CAAGGTAATCTCCTGATCCATGG + Intronic
976190022 4:82478587-82478609 ATGGGTACTCTTTTGGTGCAGGG - Intergenic
976205810 4:82622300-82622322 CATGGTAAGCTCTTGCTGCTGGG + Intergenic
980409301 4:132394883-132394905 CAGAGTTCTCTTTTGGTGCATGG - Intergenic
981058642 4:140395237-140395259 CAGGGGAATCTCTTGGACCCTGG - Intronic
982043333 4:151417010-151417032 CAGGGGAATCTCTTGGGCCGGGG - Intronic
982076928 4:151747121-151747143 CATGGTAAGCACTTGGTACATGG + Intronic
988102583 5:26701512-26701534 CAGGAGAATCTCTTGATCCAGGG - Intergenic
989128812 5:38083679-38083701 CAGGGGAATGTCTTGGAGGAAGG - Intergenic
990430516 5:55730556-55730578 CTGGGAAATCTCTTTGTGCCCGG + Intronic
995877208 5:116803050-116803072 CAGGGGAATCTCTTGGACCCGGG - Intergenic
997437069 5:133883321-133883343 CAGGGTTCTCCCTTGGTGCGGGG - Intergenic
1001853857 5:174993775-174993797 AAGATTATTCTCTTGGTGCATGG - Intergenic
1004769582 6:18766964-18766986 CAGGGTTAACTCTTGGTCCATGG + Intergenic
1005636514 6:27758051-27758073 CAGGGTAATCGCTTGAACCAGGG + Intergenic
1007688674 6:43683337-43683359 CAGGGTGGTGTCTTAGTGCAGGG + Intronic
1009054276 6:58316475-58316497 CAAGGGAATCTCTTGGTGTGTGG - Intergenic
1009399705 6:63239808-63239830 CAGGGTCATCTGTTGGGGCAGGG + Intergenic
1010311843 6:74396331-74396353 CAAAGAAATCTTTTGGTGCAGGG - Intergenic
1013787899 6:113802693-113802715 CAGGATAATCTCTTGGACCCAGG + Intergenic
1013823016 6:114178250-114178272 CAGAGACATCTCTTGGTGAATGG + Intronic
1020192605 7:6011705-6011727 CACGGCACTCTCTAGGTGCAGGG - Intronic
1020774448 7:12435605-12435627 CAGGAGAATCTCTTGGACCAGGG + Intergenic
1023465499 7:40450019-40450041 CAGGAGAATCGCTTGGAGCAAGG - Intronic
1023940395 7:44765551-44765573 CAGGGTAGTCGCTGGGGGCAGGG - Exonic
1025478871 7:60958005-60958027 CCAGGGCATCTCTTGGTGCAAGG - Intergenic
1025562200 7:62381751-62381773 CAGGGGGATCTTTTGGTGCAAGG - Intergenic
1026491795 7:70869940-70869962 CAGGGGAATCACTTGGAGCCGGG - Intergenic
1027507375 7:79034147-79034169 AAGAGTAATCTTTTAGTGCATGG + Intronic
1028156315 7:87434019-87434041 CAGGGTAATCGCTTGATCCCAGG - Intronic
1028904840 7:96141253-96141275 CAGGGCAATCTCTTAATGCCAGG - Intronic
1029716651 7:102331726-102331748 CACGGCACTCTCTAGGTGCAGGG + Intergenic
1031457329 7:121998138-121998160 CCGGGTAATTTTTTGGGGCATGG + Intronic
1032419412 7:131765767-131765789 CAGGGTAGGCTCTTGGTTAAGGG + Intergenic
1032704662 7:134411556-134411578 CAGAGGAGTCTCTTGCTGCAAGG - Intergenic
1032869370 7:135966402-135966424 GATGGTACTCTCATGGTGCAGGG - Intronic
1033308179 7:140239901-140239923 CTGGGTGATCCCTGGGTGCAGGG - Intergenic
1035431382 7:158825346-158825368 CAGGGTAGTCTAATGGTCCAGGG + Intronic
1035526214 8:315283-315305 TAGGGTACTTTCTTGGTGGAAGG + Intergenic
1036508616 8:9379729-9379751 GAGGGCCATCTCTGGGTGCAGGG - Intergenic
1045099251 8:98828065-98828087 CAGGATAATCTCTTGAACCAGGG - Intronic
1046380067 8:113438275-113438297 CAGGGTAATGCTGTGGTGCACGG - Intergenic
1047396502 8:124504837-124504859 CAGGAGAATCTCTTGAAGCAGGG - Intronic
1048272358 8:133039808-133039830 CAAGGGAATCCCTGGGTGCAGGG - Intronic
1048942314 8:139411821-139411843 CAGGATAATCACTTGAGGCAAGG - Intergenic
1056378271 9:86035275-86035297 CAGGGTGATATGTTGGTGCTGGG + Intronic
1057946671 9:99336226-99336248 CAGGTGAATCTCTGGGTTCATGG + Intergenic
1057991553 9:99776008-99776030 CAGGGTATTCTCCTGGAGCAGGG - Intergenic
1058054531 9:100436239-100436261 CAGGGTGATCACTTGGGCCAAGG - Intronic
1060644776 9:125268590-125268612 CAGGGGAATCTCTTGAGACAGGG - Intronic
1188111572 X:26200178-26200200 CAGGAGAATCTCTGAGTGCATGG + Intergenic
1188492159 X:30749264-30749286 CAGGGGAATCGCTTGAGGCAGGG - Intergenic
1189515344 X:41708023-41708045 CAGGATAATCTCTTGAACCAGGG + Intronic
1189515416 X:41709154-41709176 CTTGGTAATCTTTTGGTGAATGG - Intronic
1192217774 X:69175883-69175905 GAGGGTAATCCCATGGTGGAAGG - Intergenic
1192528661 X:71868732-71868754 CAGGGTAGTCTCTTGGTTGGAGG - Intergenic
1195812605 X:108851208-108851230 GAGGGGAATCTCCTGATGCATGG - Intergenic
1198001235 X:132439476-132439498 CATGGCAAACTCTTGGTGGATGG + Exonic