ID: 1167019133

View in Genome Browser
Species Human (GRCh38)
Location 19:46861214-46861236
Sequence GTGCGCGAGCTCACGGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167019127_1167019133 3 Left 1167019127 19:46861188-46861210 CCGCGCTGAGGGCGCCCAGCTGG No data
Right 1167019133 19:46861214-46861236 GTGCGCGAGCTCACGGGCCCCGG No data
1167019126_1167019133 9 Left 1167019126 19:46861182-46861204 CCGGGGCCGCGCTGAGGGCGCCC No data
Right 1167019133 19:46861214-46861236 GTGCGCGAGCTCACGGGCCCCGG No data
1167019123_1167019133 24 Left 1167019123 19:46861167-46861189 CCGGGATTTTGGAGGCCGGGGCC No data
Right 1167019133 19:46861214-46861236 GTGCGCGAGCTCACGGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167019133 Original CRISPR GTGCGCGAGCTCACGGGCCC CGG Intergenic