ID: 1167021167

View in Genome Browser
Species Human (GRCh38)
Location 19:46877160-46877182
Sequence AATCGCTTGATGAAACCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167021161_1167021167 14 Left 1167021161 19:46877123-46877145 CCTGTAATCCCAGCTACTCAGGA 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
Right 1167021167 19:46877160-46877182 AATCGCTTGATGAAACCAAGAGG No data
1167021165_1167021167 5 Left 1167021165 19:46877132-46877154 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1167021167 19:46877160-46877182 AATCGCTTGATGAAACCAAGAGG No data
1167021163_1167021167 6 Left 1167021163 19:46877131-46877153 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1167021167 19:46877160-46877182 AATCGCTTGATGAAACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167021167 Original CRISPR AATCGCTTGATGAAACCAAG AGG Intergenic
No off target data available for this crispr