ID: 1167022374

View in Genome Browser
Species Human (GRCh38)
Location 19:46887633-46887655
Sequence CTGAGTTGAAGGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167022374_1167022381 27 Left 1167022374 19:46887633-46887655 CCCACTTCCCTCCTTCAACTCAG No data
Right 1167022381 19:46887683-46887705 CTCCCCAAAATCCATGCTTCTGG No data
1167022374_1167022379 -7 Left 1167022374 19:46887633-46887655 CCCACTTCCCTCCTTCAACTCAG No data
Right 1167022379 19:46887649-46887671 AACTCAGTGCTCTAACCATGTGG No data
1167022374_1167022382 28 Left 1167022374 19:46887633-46887655 CCCACTTCCCTCCTTCAACTCAG No data
Right 1167022382 19:46887684-46887706 TCCCCAAAATCCATGCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167022374 Original CRISPR CTGAGTTGAAGGAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr