ID: 1167026292

View in Genome Browser
Species Human (GRCh38)
Location 19:46921455-46921477
Sequence AAAGATCTCAAGTTTATGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167026292_1167026294 -1 Left 1167026292 19:46921455-46921477 CCCAGCATAAACTTGAGATCTTT 0: 1
1: 0
2: 2
3: 22
4: 181
Right 1167026294 19:46921477-46921499 TCACCCATTTTTTAAAGATGTGG 0: 1
1: 0
2: 3
3: 77
4: 763
1167026292_1167026298 23 Left 1167026292 19:46921455-46921477 CCCAGCATAAACTTGAGATCTTT 0: 1
1: 0
2: 2
3: 22
4: 181
Right 1167026298 19:46921501-46921523 GGAAAAAAAGAACATAATCGAGG 0: 1
1: 0
2: 1
3: 30
4: 457
1167026292_1167026296 2 Left 1167026292 19:46921455-46921477 CCCAGCATAAACTTGAGATCTTT 0: 1
1: 0
2: 2
3: 22
4: 181
Right 1167026296 19:46921480-46921502 CCCATTTTTTAAAGATGTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167026292 Original CRISPR AAAGATCTCAAGTTTATGCT GGG (reversed) Exonic