ID: 1167026292 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:46921455-46921477 |
| Sequence | AAAGATCTCAAGTTTATGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 206 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 22, 4: 181} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1167026292_1167026294 | -1 | Left | 1167026292 | 19:46921455-46921477 | CCCAGCATAAACTTGAGATCTTT | 0: 1 1: 0 2: 2 3: 22 4: 181 |
||
| Right | 1167026294 | 19:46921477-46921499 | TCACCCATTTTTTAAAGATGTGG | 0: 1 1: 0 2: 3 3: 77 4: 763 |
||||
| 1167026292_1167026298 | 23 | Left | 1167026292 | 19:46921455-46921477 | CCCAGCATAAACTTGAGATCTTT | 0: 1 1: 0 2: 2 3: 22 4: 181 |
||
| Right | 1167026298 | 19:46921501-46921523 | GGAAAAAAAGAACATAATCGAGG | 0: 1 1: 0 2: 1 3: 30 4: 457 |
||||
| 1167026292_1167026296 | 2 | Left | 1167026292 | 19:46921455-46921477 | CCCAGCATAAACTTGAGATCTTT | 0: 1 1: 0 2: 2 3: 22 4: 181 |
||
| Right | 1167026296 | 19:46921480-46921502 | CCCATTTTTTAAAGATGTGGTGG | 0: 1 1: 0 2: 1 3: 20 4: 252 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1167026292 | Original CRISPR | AAAGATCTCAAGTTTATGCT GGG (reversed) | Exonic | ||