ID: 1167027414

View in Genome Browser
Species Human (GRCh38)
Location 19:46931020-46931042
Sequence CAGTACCTACAGAGGGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167027410_1167027414 25 Left 1167027410 19:46930972-46930994 CCTAGTAGAATATTTGTTGTATG 0: 1
1: 0
2: 2
3: 23
4: 253
Right 1167027414 19:46931020-46931042 CAGTACCTACAGAGGGAATTAGG 0: 1
1: 0
2: 0
3: 17
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167027414 Original CRISPR CAGTACCTACAGAGGGAATT AGG Intronic
900779424 1:4608076-4608098 CAGAACCTTCAGAGGGAGTATGG - Intergenic
901438090 1:9261752-9261774 CAGTATCTACAGAGGCAATCTGG + Intronic
903259517 1:22123859-22123881 AAGAACCCACAGAGGGAATTGGG - Intronic
903386647 1:22931199-22931221 CAGTAACTACAGTCGGAAGTTGG - Intergenic
903678554 1:25082149-25082171 CAGAGCCTGCAGAGGGAATATGG + Intergenic
910363607 1:86440049-86440071 TAGGAGCTACAGTGGGAATTTGG + Intronic
910366643 1:86472371-86472393 CAGTGCCTGCAGAGGAAATGAGG - Intronic
911335784 1:96578497-96578519 CAGTGCCACCAGATGGAATTTGG - Intergenic
911953139 1:104202773-104202795 CAGTACTCACAGAGTAAATTAGG - Intergenic
912435878 1:109660686-109660708 CAGGACCTCCTGAGGGATTTGGG + Intronic
915719427 1:157973476-157973498 TGGTAACTACAGAGGGAAGTGGG - Intergenic
915986717 1:160473361-160473383 CAGTAGCTAGAGAGAGAAGTGGG + Intergenic
916244000 1:162668502-162668524 TAGAACCTTCAGAGGGAATATGG - Intronic
917199461 1:172499729-172499751 CAGGATCAACAGAGGGACTTAGG - Intergenic
921730714 1:218575218-218575240 CAGTTGCTACAGACTGAATTAGG - Intergenic
923858674 1:237871344-237871366 GAATTCCTGCAGAGGGAATTTGG - Intergenic
1068481803 10:57599101-57599123 CAGTAACCACAGGGGTAATTGGG + Intergenic
1069670224 10:70196096-70196118 CAGTCCCTTCAGAGGGAATACGG + Intergenic
1078343276 11:10517630-10517652 CATTACCTACAGAGGAAAAAAGG + Intronic
1079775518 11:24520943-24520965 CATTAGCTCCAGAGGGAAATAGG + Intronic
1080080749 11:28215546-28215568 CAGTACCTAGAAAGGGAAATGGG + Intronic
1080282291 11:30571032-30571054 CACTACCAACAGAGGAACTTCGG + Intronic
1086968002 11:93050166-93050188 CAGGACCGACAGAGGGAATCTGG + Intergenic
1088154966 11:106791333-106791355 CAGCTACTACAGGGGGAATTGGG + Intronic
1088882188 11:113981044-113981066 CAGTTACTGCTGAGGGAATTGGG + Intronic
1092828960 12:12425381-12425403 AAGTAACTAAAAAGGGAATTTGG - Intronic
1097816691 12:64082381-64082403 CAGCAGCTAAAGACGGAATTTGG - Intronic
1101049052 12:100842010-100842032 CAGAAGCTACACAGAGAATTTGG - Intronic
1103160883 12:118728280-118728302 CAGTTACTACAAAGGAAATTGGG + Intergenic
1105460370 13:20579792-20579814 TAGTACATACAGTGGGACTTGGG - Intronic
1107320594 13:39182817-39182839 CAATACATACAGGGGGAATCTGG + Intergenic
1107819431 13:44272866-44272888 CAGTACCTCCAGGGGCAAGTAGG + Intergenic
1107876376 13:44794219-44794241 TAGGATCTGCAGAGGGAATTGGG + Intergenic
1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG + Intronic
1120281547 14:82444732-82444754 CTGTTCCTACAAAAGGAATTGGG - Intergenic
1121577107 14:94997271-94997293 GAGCACCGTCAGAGGGAATTCGG - Intergenic
1122567955 14:102675563-102675585 TAGCACCTACAGAGGGGATGTGG + Intronic
1123167969 14:106344574-106344596 CAGTAGCTACTGAAGGAACTCGG - Intergenic
1202854140 14_GL000225v1_random:39619-39641 CTCTGCCTACAGGGGGAATTGGG - Intergenic
1127858481 15:62972798-62972820 CAGTACCAAAAGAGGGATTAGGG - Intergenic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1129226384 15:74172878-74172900 CAGCACCAACAGTGGGATTTTGG + Intergenic
1130571151 15:85045035-85045057 CAGGACCTACAGTGGAAATAAGG - Intronic
1130824982 15:87534482-87534504 GAGAACCTCCAGAGGGGATTAGG - Intergenic
1131441949 15:92466250-92466272 CAGTTCCCACAGAGGCTATTAGG - Exonic
1135539685 16:23320477-23320499 CAGTTCTCACTGAGGGAATTAGG + Intronic
1137532116 16:49284309-49284331 CAGGACATAGAGAGGGAGTTAGG - Intergenic
1141115272 16:81303367-81303389 CAGCACCTACACAGTGAACTCGG - Intergenic
1142561636 17:813200-813222 CAGTTCCTTCAGAGGTATTTCGG + Intronic
1142888284 17:2927041-2927063 TAGAGCCTACAGAGGGAATGCGG - Intronic
1143447528 17:7018212-7018234 GAGTTCCTACAGAGGGAAGATGG - Intergenic
1143968986 17:10778832-10778854 CAGGACCTACAGTGGGTGTTGGG - Intergenic
1145797685 17:27665513-27665535 CAGGTCCTACAGAGGGCATTTGG - Intergenic
1150601006 17:66651017-66651039 CTGTACCTGCAGTGGGAGTTTGG + Intronic
1155279436 18:24223986-24224008 TAGTAACTACAGAGGGAATCGGG + Intronic
1158244699 18:55418961-55418983 CAGCACCAACAGAGTGCATTGGG + Intronic
1161793218 19:6373120-6373142 CGGTACCTAGAGCGGGGATTTGG + Intronic
1166641307 19:44497519-44497541 CAGTACATACACAGGTATTTGGG - Intronic
1167027414 19:46931020-46931042 CAGTACCTACAGAGGGAATTAGG + Intronic
1167099043 19:47392709-47392731 CAGAACTTACAGTGGGAGTTTGG - Intergenic
1167180741 19:47901535-47901557 CAGAGCCTCCAGAGGGAATGTGG + Intergenic
926719258 2:15947072-15947094 CATAACCTATAGAGGGAATTTGG + Intergenic
927236829 2:20882412-20882434 CTGCACCAACAGAGGGAATAGGG - Intergenic
935171280 2:100612928-100612950 CAGTACCTACAGAGGCCATGGGG - Intergenic
935219449 2:101000271-101000293 CAGCACCTAGAGAGGGATTAAGG - Intergenic
937181592 2:120001039-120001061 CAGTAACCACAGAGGCCATTGGG - Intergenic
940158737 2:150688496-150688518 GAGTACCTACAGATGCCATTTGG + Intergenic
940966867 2:159847835-159847857 CATTACCTGCAGAGAGATTTTGG - Intronic
944839941 2:203615248-203615270 CAGTAGCTAGAGTGGGATTTAGG + Intergenic
946527143 2:220532904-220532926 CATTCCCTGCAGAGGGAATTTGG + Intergenic
948265832 2:236634764-236634786 GAGTACCTAGAGATGGCATTGGG - Intergenic
1168770971 20:416518-416540 TAGTACCTTCAGAGAGATTTGGG - Intronic
1168930079 20:1614632-1614654 CAGTTCCTAGAGAAGGAAGTAGG - Intronic
1168939962 20:1700898-1700920 CAGGTCCTAGAGAGGGAAGTAGG - Intergenic
1171361533 20:24589797-24589819 TAGTACCAGCAAAGGGAATTGGG + Intronic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1179198734 21:39193178-39193200 CTGCACCTAAAGAGGAAATTGGG - Intronic
1182684850 22:32114110-32114132 CTGTCCCTACAGAGTGAAGTTGG - Intergenic
1183256877 22:36768116-36768138 CAGAACTTACAGAGGGCTTTGGG + Intronic
1183641742 22:39097035-39097057 CTGTACCTGGAGAGGGAATTGGG + Intergenic
949944715 3:9180770-9180792 CAGGATCTACAGTGGGAACTGGG - Intronic
951219816 3:20057201-20057223 CAGTGCCAACAAAGGGAATAGGG + Intronic
952793731 3:37220549-37220571 CAGTCCCTGCAAAGGGAAATGGG - Intergenic
955313119 3:57910043-57910065 GAGTTCCTACAGAGGGCCTTTGG + Intronic
956942838 3:74183853-74183875 CAGAAACTAAAGAGGGAATGGGG + Intergenic
959127502 3:102307920-102307942 CAGTACTTGCAGTGGGACTTAGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962967020 3:140364838-140364860 CAGTCCTTACAGTGGGCATTGGG + Intronic
963680541 3:148370076-148370098 CATTACCTGCAGAGGGAACTGGG + Intergenic
963969093 3:151409337-151409359 CAGTACCTACAAAGCAAATGTGG - Intronic
966004217 3:174988602-174988624 TAGTGCCTTCAGAGGGAATATGG - Intronic
967234221 3:187368571-187368593 CAATACCAACAGAGAGCATTTGG + Exonic
967486404 3:190036728-190036750 CAGATTCTACAGAGGGAACTTGG - Intronic
967838449 3:193984085-193984107 CAGAGCCTTCAGAGGGAATGTGG + Intergenic
971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG + Intergenic
975088423 4:70371483-70371505 AAGTACCTAGAGAGGACATTTGG - Intronic
977175784 4:93817907-93817929 CAGTAAATACAGTAGGAATTGGG - Intergenic
980638323 4:135538850-135538872 CAATACATACTGAGGGAACTCGG + Intergenic
987318229 5:16744312-16744334 CAGTACCTACTGAGGGAGGGTGG - Intronic
989611709 5:43300057-43300079 CAGCACCAACAGTGGGACTTTGG - Intronic
989825011 5:45843160-45843182 CAATACCTAAAGATGGAATTGGG - Intergenic
990210302 5:53476510-53476532 CAGTACCTAAAAAGAGAATATGG - Intergenic
992352684 5:75947247-75947269 CATTACTTCCACAGGGAATTGGG - Intergenic
995874001 5:116771257-116771279 CTGTACCTGAAGAGGGAATCTGG - Intergenic
995984488 5:118152757-118152779 CATTACTTACAGAAGGAAATAGG + Intergenic
1000683940 5:164223727-164223749 CAGTCCCAAGAGAGGGAACTAGG + Intergenic
1002679146 5:180947865-180947887 CAGTACCTATAGAGAGAGCTTGG + Intronic
1002980978 6:2137633-2137655 CAGTACTTAAAAAGGGAATATGG - Intronic
1007930313 6:45685088-45685110 CAGTAACCTCAGAGGGAATGAGG + Intergenic
1008975275 6:57418764-57418786 CAGTCTCTATAGAGGGACTTAGG + Intronic
1010386988 6:75291478-75291500 CAGTATCTACAGAGGCATTTGGG - Intergenic
1011022832 6:82833386-82833408 CATTATCTACAGAAGTAATTGGG + Intergenic
1013231083 6:108163084-108163106 AAGCGCCTACAGAGGAAATTAGG + Intronic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1016502590 6:144738377-144738399 CCAAACCTCCAGAGGGAATTAGG + Intronic
1016509260 6:144822322-144822344 CATTACCTATAGAGGGAAAAAGG - Intronic
1017550242 6:155498171-155498193 CAGTGGTTACAGAGGGAGTTTGG + Intergenic
1020576522 7:9938126-9938148 GAGTACATACACAGGGAATTTGG + Intergenic
1021247347 7:18280148-18280170 CAATATTTAAAGAGGGAATTTGG + Intronic
1023521969 7:41058379-41058401 CAGCACCTCAAGAGTGAATTTGG - Intergenic
1023917558 7:44601476-44601498 CTGTACCTAGAGAAGGTATTGGG - Intergenic
1025723206 7:64035113-64035135 CATTACCTAAAGAGGGAACAGGG + Intronic
1031146492 7:118002801-118002823 CAGTGCCTACAGAAGGGAGTTGG + Intergenic
1032577379 7:133069622-133069644 CAGGACCTACAGATAAAATTAGG + Intronic
1036732476 8:11277985-11278007 CAGTACCTCCATAGGCTATTTGG - Intergenic
1037431437 8:18817377-18817399 CATGACCTACAGGGTGAATTAGG - Intronic
1037606603 8:20443015-20443037 CAGTAGCTAGAGAGGGAACTGGG + Intergenic
1044145569 8:88709669-88709691 CAGTACCTTCAGAAGGATTAGGG - Intergenic
1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG + Exonic
1047428242 8:124766246-124766268 CAATACCTAGAAAGAGAATTAGG - Intergenic
1047568192 8:126069266-126069288 AAGTAGCTTCAGAGGGAATCTGG + Intergenic
1047818946 8:128497027-128497049 CAGTGCCTTCAGTGGTAATTTGG + Intergenic
1047853835 8:128888397-128888419 CTGTAACTACAGTAGGAATTAGG + Intergenic
1048190425 8:132283035-132283057 CCGAACATACAGAGGGAATGAGG + Intronic
1048344554 8:133566895-133566917 CAGGACCTAAGGAGGGAAATGGG + Intronic
1048968683 8:139631792-139631814 TATTACTTACAGAGGGTATTAGG - Intronic
1050013430 9:1208636-1208658 CAGCACCTTCAGAGGGGATAAGG - Intergenic
1050760064 9:9058153-9058175 CAGAATATAAAGAGGGAATTAGG + Intronic
1055213751 9:73833294-73833316 CAGTACAAAGAGATGGAATTTGG + Intergenic
1055722228 9:79188199-79188221 CAGTACTTACAGATGAATTTAGG - Intergenic
1185579899 X:1203697-1203719 TAGAACCTCCAGAGGGAATGCGG + Intronic
1188954690 X:36420025-36420047 TAGCACCTTCAGAGGGAATGTGG + Intergenic
1189346031 X:40242083-40242105 TAGAACCTACTGAGGGAATGGGG - Intergenic
1189754878 X:44260855-44260877 GAGTCTCTACAGAGAGAATTGGG + Intronic
1194943253 X:100038256-100038278 CAGTACCTTGACTGGGAATTTGG + Intergenic
1195761701 X:108253634-108253656 CAGTACCTACACAGGGCTCTAGG - Intronic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1199038203 X:143078593-143078615 CACTGCCTACTGAGGGAAATGGG - Intergenic
1200892653 Y:8340140-8340162 CACTGCCTACAAAGGGCATTGGG + Intergenic