ID: 1167031662

View in Genome Browser
Species Human (GRCh38)
Location 19:46966051-46966073
Sequence CTGGATGTACAAGTGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167031662 Original CRISPR CTGGATGTACAAGTGAAGCT AGG (reversed) Intronic
902329785 1:15725602-15725624 CTGGATGAACAGCTGATGCTGGG - Intronic
905949244 1:41933886-41933908 CTGGATTCAGAAGTGAAGCAGGG - Intronic
906099155 1:43245649-43245671 CTGGAGGTGGAAGTGAAGGTAGG + Intronic
906662831 1:47594647-47594669 CTGCATGGTCAAGTGAAGCAAGG - Intergenic
907582713 1:55586385-55586407 CTTAGGGTACAAGTGAAGCTGGG + Intergenic
908087758 1:60654395-60654417 CTGGATCTACTGCTGAAGCTAGG - Intergenic
910442399 1:87266072-87266094 CTGGATGTAGAGGTCAAGGTGGG + Intergenic
917579915 1:176365636-176365658 CTGGATCTTGAAGGGAAGCTGGG - Intergenic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
918279112 1:182985682-182985704 CTGGATGTAGAAGTCTAGGTTGG + Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
922436175 1:225608943-225608965 CTGTATTTACAAGTCAAGGTTGG - Intronic
922889216 1:229047446-229047468 CGGGAAGTACCAGAGAAGCTGGG + Intergenic
1064569744 10:16680282-16680304 CAGAATGTACACGTGAAGCCTGG + Intronic
1069098175 10:64286080-64286102 ATGGAGATAAAAGTGAAGCTTGG + Intergenic
1070647989 10:78214763-78214785 CTGGATGTCCAAGAGAGGCACGG - Intergenic
1075733981 10:124652958-124652980 CTGGGTGCACAAGGGAAGGTAGG - Intronic
1075973309 10:126673252-126673274 CTGGATGGACAATTGGAGATGGG + Intergenic
1081652412 11:44833183-44833205 CTGGATGGACACGTGAACCTGGG + Intronic
1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG + Intergenic
1088350661 11:108883917-108883939 CTGGAAGTAGAAGAGAAGTTAGG - Intronic
1089754705 11:120678132-120678154 CTGGAGGTGCAAGAGAAGGTAGG + Intronic
1091533125 12:1379356-1379378 CTGGATCTTCAAGGGAAGCAAGG - Intronic
1093947518 12:25126532-25126554 CTGGATATAAAAGTAAAGCAAGG + Intronic
1096961303 12:55580710-55580732 ATGGCTGTTCAAGTGAACCTGGG - Intergenic
1099200148 12:79666944-79666966 CTGAAGGGAAAAGTGAAGCTGGG + Intronic
1100061570 12:90583987-90584009 CAGGAGGTAAAAGTGAAGCAAGG + Intergenic
1102529776 12:113537772-113537794 CTGGATGTTTAAAGGAAGCTGGG - Intergenic
1103422354 12:120797568-120797590 CTGGAAGTACAAGTGGCTCTAGG + Intronic
1104985697 12:132595710-132595732 CTGGATTTATAAGTGAATTTGGG + Intergenic
1111940568 13:94602187-94602209 CTGGAGGTCCAGGTGAGGCTGGG - Intronic
1113515502 13:110893176-110893198 CTGGAGGTTCAAGAGAAACTGGG + Exonic
1113625460 13:111793064-111793086 CTGCAGGTACAAGAGAGGCTGGG - Intergenic
1117823071 14:59671700-59671722 CTGTCTGTACCAGAGAAGCTGGG + Intronic
1119416532 14:74474123-74474145 ATGGATGTGCATGTGTAGCTTGG - Intergenic
1119514731 14:75239245-75239267 CTGGATGGGGAAATGAAGCTAGG + Intronic
1120563971 14:86031787-86031809 ATGGATGTATAAGTGAAACATGG - Intergenic
1121401193 14:93678778-93678800 GTGAATTTACATGTGAAGCTGGG + Intronic
1125826701 15:42682563-42682585 CTGGCTGTACCTGTGTAGCTGGG - Exonic
1128053022 15:64680271-64680293 CTGGATTTACAAGTCACACTGGG - Exonic
1128257996 15:66212411-66212433 CTGGCTGCAAAAGGGAAGCTAGG + Intronic
1128685254 15:69679631-69679653 CTGGATGTACATCTAAAGCCAGG + Intergenic
1131083305 15:89554876-89554898 CTGGCTTTACAAAGGAAGCTAGG + Intergenic
1137528256 16:49256545-49256567 CTGGATGTAGAAGTCTAGGTTGG - Intergenic
1140096409 16:71879460-71879482 CTGTATGTACTAGAGAAGTTCGG - Intronic
1141327879 16:83079397-83079419 CTGGATGTGGAACTGAAGCAAGG + Intronic
1143089208 17:4438892-4438914 CTGGGTGTATGAGTGAGGCTGGG + Intronic
1147712322 17:42477914-42477936 CTGGGTCCATAAGTGAAGCTGGG + Intronic
1152095642 17:78270093-78270115 CTGGCTGCAGAAGTGAGGCTGGG - Intergenic
1164857769 19:31538417-31538439 CTGGATTTACAGGTGAGGGTGGG - Intergenic
1165403571 19:35617101-35617123 CTGGAGGGAGAAGTGCAGCTGGG - Intronic
1166122648 19:40694645-40694667 TTGGATGTGCATGTGAAGCCTGG - Intronic
1167031662 19:46966051-46966073 CTGGATGTACAAGTGAAGCTAGG - Intronic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
925841071 2:7992882-7992904 CTGGATGTACAAGTGAATAAAGG + Intergenic
928561836 2:32496517-32496539 CTGTATGAACAAATGAGGCTGGG - Intronic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
931222981 2:60305039-60305061 GTTGATGTACAACTGAAGATAGG - Intergenic
934656452 2:96118891-96118913 CAGGATGGACAAGTGCAGCGTGG + Intergenic
934884973 2:98016454-98016476 CTGGAGGTACATGTGAGGATGGG + Intergenic
940405794 2:153300403-153300425 CTGGATGTACAGGGAAAGCTGGG + Intergenic
942329532 2:174807340-174807362 CTGGAAGTAAAACTGAAGCTTGG - Intronic
943088362 2:183343729-183343751 CTAGATGTGCAAGTTATGCTAGG + Intergenic
945835216 2:214831627-214831649 CTGGATCCACAAGTGAACATCGG - Intergenic
946629425 2:221649974-221649996 CTGGAGGCAAAAGTGAAGATAGG + Intergenic
947185495 2:227451701-227451723 CTGAATGTGCAAGTGGAGGTTGG - Intergenic
1170548227 20:17453511-17453533 CTGAATTTACAATTTAAGCTGGG - Intronic
1174778152 20:53364527-53364549 CTGGCTGGACAAGTGGGGCTGGG - Intronic
1176242549 20:64081752-64081774 CTGGATGTGCAAAGGAGGCTGGG - Intronic
1178684808 21:34702537-34702559 CTGCATGTACAACTGACGCTAGG - Intronic
1178962603 21:37081008-37081030 ATGGATGTACAATTGTAGGTTGG + Intronic
1180154661 21:45972148-45972170 CTGGATGTGCCAGGAAAGCTGGG - Intergenic
1182583310 22:31328193-31328215 CTGAATCAACAAGTGAAGGTGGG + Intronic
1184996631 22:48211792-48211814 CTGGATGATCCAGTGAAGCCTGG + Intergenic
952990545 3:38827556-38827578 CTTGATATAAAAGGGAAGCTGGG - Intergenic
953218369 3:40944313-40944335 GTGGAGGTAAAAGTGAAGCCAGG + Intergenic
954930446 3:54276630-54276652 CTGATTGTACAAGAGAAGTTTGG + Intronic
955187853 3:56732276-56732298 CAGGATGGAGAAGTGAGGCTGGG - Exonic
959485045 3:106918543-106918565 CTGAATCTATAAGTCAAGCTGGG + Intergenic
961358650 3:126354330-126354352 CTGGGTGTAGAGGTGATGCTGGG - Intronic
963804230 3:149707213-149707235 CTGCATGTGCTAGTGAAGCCTGG - Intronic
966357186 3:179093463-179093485 CTTGATTTTCAAGAGAAGCTAGG - Intergenic
969106013 4:4807611-4807633 CTGAAGGAACAAGTGAAGCAGGG + Intergenic
969998241 4:11337144-11337166 TTGGCTGTAAAAGTGAAACTGGG + Intergenic
970022859 4:11588491-11588513 CTGGAGGTAGAAGTGAAACCAGG - Intergenic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
974338094 4:60577682-60577704 CTGGATATAGAAGTCTAGCTGGG - Intergenic
975547174 4:75571558-75571580 CTGGGTGTAAAAATAAAGCTGGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978834113 4:113127176-113127198 CTTGATGGAAAAGTGAAGCATGG - Intronic
985203536 4:187507822-187507844 CTGGATCTAGAACTGAAGCTTGG - Intergenic
988970239 5:36459553-36459575 CTGCAGCTACAAGGGAAGCTGGG - Intergenic
991184402 5:63790353-63790375 CTGGATCTTCAAAAGAAGCTGGG - Intergenic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
993866969 5:93207280-93207302 GTGGATGTACAATTTAAGCTTGG + Intergenic
996812944 5:127540625-127540647 CTGGATGTAGAAGTCTAGGTTGG + Intronic
1000786553 5:165551614-165551636 CAGGGTGTAGAAGTGAAGGTGGG - Intergenic
1003976519 6:11350182-11350204 CTGGATGTACATGAAAAGATTGG - Intronic
1011468620 6:87685564-87685586 CTGATAATACAAGTGAAGCTTGG - Intronic
1011707874 6:90021035-90021057 GTGTATGTACATGTGCAGCTGGG - Intronic
1020961459 7:14809420-14809442 CTTCAAGTTCAAGTGAAGCTAGG + Intronic
1023052780 7:36267637-36267659 CTGCATGTAAAACTGCAGCTGGG - Intronic
1024315139 7:48009234-48009256 CATGATGTACAGGTGAGGCTAGG - Intronic
1028007739 7:85597674-85597696 TTGAAGGTATAAGTGAAGCTTGG - Intergenic
1029504608 7:100955233-100955255 ATGGTTGAAGAAGTGAAGCTGGG - Exonic
1029575496 7:101400870-101400892 CTGAATGAACAAGTGAAGGAAGG - Intronic
1034181587 7:149142931-149142953 CTGAATGTAAAACTGAAGATGGG - Intronic
1042146880 8:65739011-65739033 CTGCATGCAGAAGTGAAGGTGGG + Intronic
1042510112 8:69602519-69602541 CCTGATGTAACAGTGAAGCTAGG + Intronic
1045074174 8:98544134-98544156 CTGGATATAGAAGTGAAGGGAGG + Intronic
1050900452 9:10941402-10941424 TTAGTTGTAAAAGTGAAGCTGGG + Intergenic
1056025732 9:82493000-82493022 CTGGATATAAAAGTGAAAATAGG + Intergenic
1058837722 9:108873979-108874001 CTGGATGTATGAGTTTAGCTGGG + Intronic
1193285321 X:79707304-79707326 ATGCATGTAAAAGTTAAGCTTGG + Intergenic
1195254064 X:103076524-103076546 CTAAAGGTAAAAGTGAAGCTGGG + Intronic
1200036005 X:153330899-153330921 CTGTAGCTACAAGAGAAGCTGGG + Intergenic