ID: 1167033338

View in Genome Browser
Species Human (GRCh38)
Location 19:46978173-46978195
Sequence TTATCCTAGATTGCAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167033333_1167033338 13 Left 1167033333 19:46978137-46978159 CCACATGTTGAGAAGTTTGTGTT 0: 1
1: 0
2: 0
3: 20
4: 243
Right 1167033338 19:46978173-46978195 TTATCCTAGATTGCAGGGACTGG 0: 1
1: 0
2: 1
3: 9
4: 111
1167033331_1167033338 20 Left 1167033331 19:46978130-46978152 CCCGAGGCCACATGTTGAGAAGT 0: 1
1: 1
2: 5
3: 38
4: 257
Right 1167033338 19:46978173-46978195 TTATCCTAGATTGCAGGGACTGG 0: 1
1: 0
2: 1
3: 9
4: 111
1167033329_1167033338 22 Left 1167033329 19:46978128-46978150 CCCCCGAGGCCACATGTTGAGAA 0: 1
1: 0
2: 2
3: 9
4: 114
Right 1167033338 19:46978173-46978195 TTATCCTAGATTGCAGGGACTGG 0: 1
1: 0
2: 1
3: 9
4: 111
1167033330_1167033338 21 Left 1167033330 19:46978129-46978151 CCCCGAGGCCACATGTTGAGAAG 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1167033338 19:46978173-46978195 TTATCCTAGATTGCAGGGACTGG 0: 1
1: 0
2: 1
3: 9
4: 111
1167033332_1167033338 19 Left 1167033332 19:46978131-46978153 CCGAGGCCACATGTTGAGAAGTT 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1167033338 19:46978173-46978195 TTATCCTAGATTGCAGGGACTGG 0: 1
1: 0
2: 1
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167033338 Original CRISPR TTATCCTAGATTGCAGGGAC TGG Intronic
900778484 1:4601707-4601729 TTTTCATTAATTGCAGGGACAGG - Intergenic
901465440 1:9418155-9418177 TGCTCCTAGATTGAAGGGAGTGG - Intergenic
904162975 1:28535032-28535054 TTGTCCTAGAAGGGAGGGACAGG - Exonic
904966416 1:34377830-34377852 TTATTCTAGTTTGGAGAGACAGG - Intergenic
906952241 1:50344352-50344374 CTTTCCCAGATTCCAGGGACAGG + Intergenic
911041892 1:93597893-93597915 TGGTCCTAGCTTGCTGGGACTGG + Intronic
913220818 1:116658905-116658927 CTCTCCTAGAGGGCAGGGACGGG + Intronic
914931110 1:151934321-151934343 TTATCCTGGATTACATGGGCAGG - Intergenic
918108468 1:181434049-181434071 TCATCTTAGATTCCAGGGATGGG - Intronic
921837079 1:219789353-219789375 TTATGCTAGATGCCAGGGATTGG + Intronic
1064028233 10:11866513-11866535 TCATCCTAGAGTACAGGGATTGG - Exonic
1066105705 10:32155007-32155029 TTATCCTAGATGGGGGGCACAGG + Intergenic
1069363216 10:67668429-67668451 TTATCATAGTTTGCAGGTATAGG - Intronic
1073745522 10:106464214-106464236 TTATTCTAGATGGCTTGGACAGG + Intergenic
1073763437 10:106655745-106655767 TTCTTCTAAATTTCAGGGACAGG - Intronic
1076775580 10:132696133-132696155 TTCTCCTAGTTTGGAGGGATGGG - Intronic
1078957224 11:16213099-16213121 TTATCCTAGATTTGAGGTCCAGG - Intronic
1083934697 11:65864142-65864164 TTATCCAAGACTGCAGGGGCTGG - Intronic
1084916297 11:72431564-72431586 CTGGCCTAGATTCCAGGGACAGG + Intronic
1088603625 11:111507839-111507861 GTGTCCTTGATAGCAGGGACTGG + Intronic
1090565629 11:127988980-127989002 ACATTCTAGATTGCAGGGAGGGG - Intergenic
1092805315 12:12216850-12216872 TAATCCCAGATTGCAGGGGCAGG - Intronic
1093229642 12:16527965-16527987 TTATCCAAGTTTGCAGAGCCAGG + Intronic
1094799737 12:34019223-34019245 TTATCCTTGGTTACAAGGACTGG - Intergenic
1095112526 12:38313542-38313564 TTATCCTTGGTTACAAGGACTGG - Intergenic
1097323663 12:58252274-58252296 TTATCCGAGGGTGCTGGGACAGG + Intergenic
1101259512 12:103013828-103013850 TTATCAGAGACTGAAGGGACTGG - Intergenic
1101425665 12:104586204-104586226 TTGTCCTAGAAGGCAGGAACAGG - Intronic
1108775332 13:53758797-53758819 TTATCATACCTTGCAGGGATTGG + Intergenic
1110146975 13:72203408-72203430 TTATCCTAGGTTTCAGTGAAAGG + Intergenic
1112167978 13:96940445-96940467 TTAACCCTGTTTGCAGGGACTGG + Intergenic
1117293808 14:54360673-54360695 TTATTCTAGCTTTCAGAGACTGG + Intergenic
1121574571 14:94973272-94973294 TAGTGCTAGATTCCAGGGACTGG - Intergenic
1125452139 15:39820135-39820157 TTCTCCTTCCTTGCAGGGACAGG - Intronic
1126401292 15:48273386-48273408 TTATCCTAGATTACCTGGATGGG - Intronic
1131552430 15:93368981-93369003 TTCTCCCTGCTTGCAGGGACAGG + Intergenic
1135117830 16:19738674-19738696 TCTTCCTAGGTTCCAGGGACTGG - Intronic
1138926549 16:61598638-61598660 GTAACCTAGAATACAGGGACAGG - Intergenic
1140345137 16:74206152-74206174 TGATTCCAGATTGCAGGGAGAGG - Intergenic
1144680437 17:17189823-17189845 TGATCCCAGCTTGCAGGGAAGGG - Exonic
1148178511 17:45586793-45586815 TGATCCTAGATGGCCGGGATGGG + Intergenic
1148552038 17:48556178-48556200 TAAATCTAGATTGGAGGGACAGG + Intronic
1150417027 17:64996055-64996077 TTATCCTGGATTACATGGATGGG + Intergenic
1152555277 17:81049926-81049948 TTATCCTAGAACACAGGCACGGG - Intronic
1153276927 18:3376668-3376690 TTATCCTGGATTACTGGGATGGG - Intergenic
1157724149 18:49950787-49950809 TTGTTTTAGATTGCAGGTACTGG - Intronic
1159585530 18:70280304-70280326 TAATCCTAGATTCAAGGGAAAGG + Intergenic
1165242204 19:34477875-34477897 TTATCCCAGCTTGCAAGAACTGG + Intergenic
1166625959 19:44356407-44356429 AGATCCTACATCGCAGGGACTGG - Intronic
1167033338 19:46978173-46978195 TTATCCTAGATTGCAGGGACTGG + Intronic
926342671 2:11917397-11917419 TTATACTTTATTGCAGGGAAAGG + Intergenic
927699120 2:25256848-25256870 TATTCCTAGAGGGCAGGGACTGG + Intronic
929085828 2:38166370-38166392 TGATCCTCAATTGAAGGGACAGG - Intergenic
932190101 2:69734050-69734072 TTATCCTAGGCTGCAGGGTTGGG + Intronic
933943249 2:87262796-87262818 TTATCCTTGGGTGCAGGGGCTGG + Intergenic
936336965 2:111598765-111598787 TTATCCTTGGGTGCAGGGGCTGG - Intergenic
938547485 2:132347741-132347763 GGATCCTACATCGCAGGGACTGG + Intergenic
943411216 2:187550915-187550937 TTATCATAGAATTCAAGGACTGG + Intronic
946803714 2:223449091-223449113 TTATCACAGATTGCAGGCATAGG + Intergenic
947451420 2:230212449-230212471 TTATTACAGATTGCAGGGACTGG + Intronic
1174948629 20:55017863-55017885 GTATCCTATATGGCAGGCACTGG + Intergenic
1185170388 22:49290439-49290461 TTATTCTTCATTCCAGGGACTGG - Intergenic
1185235954 22:49713175-49713197 GTATCATAGATTGCCGGGGCAGG - Intergenic
953611180 3:44448894-44448916 TTATCCCAGATTACAGGGAAGGG + Intronic
954413625 3:50382171-50382193 TTGTCCTAGTGTCCAGGGACAGG - Intronic
956528523 3:70190942-70190964 TCATCCCTGATTTCAGGGACTGG + Intergenic
963239631 3:142990555-142990577 TTATCTAACATTGTAGGGACAGG - Intronic
970883083 4:20954933-20954955 TCATCCTTTATTGCAGAGACTGG + Intronic
972932437 4:44089994-44090016 TTCTCTTAGATTTCAGGGATAGG - Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
976508490 4:85879840-85879862 TTTTCATAGATTGCAGGGAGAGG + Intronic
978013377 4:103714688-103714710 TTTTCCTAGAGTGCAGAGAAAGG + Intronic
978223678 4:106308348-106308370 TTAGCTCAGATTGCAGGGAATGG + Intronic
980123119 4:128747796-128747818 TTATCCTAGATTAAAATGACTGG - Intergenic
984753542 4:183302451-183302473 TCAGCTTAGATTGCAGGCACAGG + Intronic
985047911 4:185959219-185959241 TTCACCTAGATTCCAAGGACTGG + Intergenic
987585500 5:19850540-19850562 TTATCCTAGTTTGCAAGGACAGG - Intronic
989259112 5:39399361-39399383 TTATCCTGGTTCTCAGGGACTGG + Intronic
990813272 5:59752907-59752929 TTATCCTACAGGGCAGGGATCGG + Intronic
991296777 5:65089996-65090018 GGATCCTAGGTGGCAGGGACTGG - Intergenic
992856827 5:80870493-80870515 TTATCCAGGTTTGCAGGCACTGG + Intronic
993542704 5:89172266-89172288 TTATCCCAGACTCCAGGGATGGG - Intergenic
993765140 5:91846322-91846344 TTAGGCTAGATTCCAGGGACTGG + Intergenic
993847941 5:92968878-92968900 TTAGCATAGATTACAGGGTCCGG + Intergenic
1002553199 5:180013305-180013327 TTATTTTATATTGCAGGCACTGG - Exonic
1002927421 6:1612518-1612540 TTATCCTATGTTGAAGGGAGGGG + Exonic
1003556601 6:7145650-7145672 TTAACCTATTTTGCAGGGTCAGG + Intronic
1004810722 6:19259010-19259032 TTATAATAGATTTCAGGGAATGG + Intergenic
1014801458 6:125782895-125782917 TTATCCTAGATTACCTGGATGGG + Intronic
1016600001 6:145847481-145847503 TTCTCCAAGATGGCAGAGACAGG + Intergenic
1020140136 7:5607353-5607375 GCATCCTAGGCTGCAGGGACAGG + Intergenic
1020457580 7:8391508-8391530 TTATCCTAGATTGCCTAGATTGG + Intergenic
1020558195 7:9695080-9695102 TTATCCAAGATTGCAGAGATAGG - Intergenic
1023937611 7:44750489-44750511 GTCTCCAAGATTGCAGGGTCAGG - Intronic
1029295224 7:99535084-99535106 CTATCCTGGTTTGCAGGGGCTGG + Intergenic
1030924856 7:115439312-115439334 TTTTCTTACATTGCAGTGACAGG - Intergenic
1031992127 7:128205371-128205393 TTATCATCGATGGTAGGGACTGG + Intergenic
1034481736 7:151326153-151326175 TTTTCCTATAAGGCAGGGACAGG - Intergenic
1035225948 7:157432282-157432304 TTGTCCCAGTTTGCAGGGACAGG + Intergenic
1036011612 8:4731613-4731635 TTCTCCTGGAGTGCAGGGATGGG - Intronic
1037611511 8:20480113-20480135 AAATGATAGATTGCAGGGACTGG - Intergenic
1038861076 8:31389555-31389577 TTCTCCTTGGTTGAAGGGACTGG - Intergenic
1041746226 8:61211770-61211792 TTATCCTAGAATACATGGATGGG + Intronic
1042611183 8:70602963-70602985 TTATCCTAGAATTCAGGAAGTGG + Intronic
1044247712 8:89968572-89968594 TTATCCTACATAGCAGGTTCTGG - Intronic
1050443015 9:5684985-5685007 TTATCCAAGAATGCAGGGTTGGG - Intronic
1050646349 9:7723746-7723768 TTATCCTAGATTATGGGGAGGGG + Intergenic
1052625173 9:30965657-30965679 GTATCCTTGAATGCAGGGAATGG - Intergenic
1052757011 9:32551553-32551575 TTAGTCTAGATTTCAGGGAGTGG - Intronic
1054873441 9:70070481-70070503 TTATACTACATTGCAGTGAGTGG - Intronic
1056887430 9:90456970-90456992 TCACCCTGCATTGCAGGGACAGG - Intergenic
1060587790 9:124797275-124797297 TTAAACTAGATTCCAGGGGCTGG - Intronic
1061646782 9:132009470-132009492 TTCTCCTAGATTGCTGGCTCTGG + Intronic
1061914066 9:133739924-133739946 TTGTCTTTGAGTGCAGGGACAGG - Intronic
1185948468 X:4404077-4404099 TTATTCTAGAATGCAGGGAAAGG - Intergenic
1186136969 X:6532427-6532449 TTATATTAGATTGTAGGGAGGGG + Intergenic
1186267318 X:7844871-7844893 TTATATTAGATTGTAGGGAGGGG - Intergenic
1190540699 X:51474953-51474975 TTGGCCTTGATTGCAGGGATAGG - Intergenic
1193541408 X:82776628-82776650 TTATCACAGAGTTCAGGGACTGG - Intergenic
1200015850 X:153163121-153163143 TTATATTAGATTGTAGGGAGGGG + Intergenic
1201438355 Y:13984523-13984545 TTATATTAGATTGTAGGGAGGGG + Intergenic
1201446218 Y:14058185-14058207 TTATATTAGATTGTAGGGAGGGG - Intergenic