ID: 1167035497

View in Genome Browser
Species Human (GRCh38)
Location 19:46992965-46992987
Sequence CTGTCCACATAGCTGCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167035488_1167035497 26 Left 1167035488 19:46992916-46992938 CCAGCTGCCTTGGGACGTTACTG No data
Right 1167035497 19:46992965-46992987 CTGTCCACATAGCTGCCCGAGGG No data
1167035490_1167035497 19 Left 1167035490 19:46992923-46992945 CCTTGGGACGTTACTGGTTCTGG No data
Right 1167035497 19:46992965-46992987 CTGTCCACATAGCTGCCCGAGGG No data
1167035493_1167035497 -7 Left 1167035493 19:46992949-46992971 CCTGCCTTCCTTTGATCTGTCCA No data
Right 1167035497 19:46992965-46992987 CTGTCCACATAGCTGCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167035497 Original CRISPR CTGTCCACATAGCTGCCCGA GGG Intronic