ID: 1167036150

View in Genome Browser
Species Human (GRCh38)
Location 19:46996058-46996080
Sequence GTGCATATGCAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167036142_1167036150 8 Left 1167036142 19:46996027-46996049 CCACCCGCTCCTCACTAGGCGTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG 0: 1
1: 1
2: 0
3: 27
4: 267
1167036143_1167036150 5 Left 1167036143 19:46996030-46996052 CCCGCTCCTCACTAGGCGTTCGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG 0: 1
1: 1
2: 0
3: 27
4: 267
1167036146_1167036150 -1 Left 1167036146 19:46996036-46996058 CCTCACTAGGCGTTCGGCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG 0: 1
1: 1
2: 0
3: 27
4: 267
1167036145_1167036150 4 Left 1167036145 19:46996031-46996053 CCGCTCCTCACTAGGCGTTCGGC 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG 0: 1
1: 1
2: 0
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167036150 Original CRISPR GTGCATATGCAGAAGGAGGC TGG Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900733130 1:4276078-4276100 GTGAAATTGCAGAAGGAGGTGGG + Intergenic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
902721940 1:18309688-18309710 GGGCAGAGGCAAAAGGAGGCCGG - Intronic
903330411 1:22594262-22594284 GTGCAAATGCTGACAGAGGCCGG - Intronic
903663214 1:24991294-24991316 GGGCATATTCAGAAGGAGTGAGG - Intergenic
904832110 1:33311978-33312000 GTGCATGTGATGAAGGAGGCGGG - Intronic
904944015 1:34185851-34185873 GTGCATCTAGAGATGGAGGCAGG - Intronic
908231984 1:62114191-62114213 GTGGATCTGCAGAAGAAAGCTGG + Exonic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
909055874 1:70820520-70820542 GGGCATATGGAGAAAGAGGAAGG + Intergenic
909374571 1:74924616-74924638 GTGCACCTGCAGGAGGTGGCTGG - Intergenic
909931213 1:81502353-81502375 GTGATGATGCAGATGGAGGCCGG + Intronic
912281903 1:108324472-108324494 GTGCTTTTGGAGACGGAGGCAGG + Intergenic
912502189 1:110129981-110130003 GAGCATATGGGGAAGGTGGCGGG + Intergenic
913961326 1:143339920-143339942 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914055679 1:144165493-144165515 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914123467 1:144800869-144800891 GTGCAGAGGCAGCAGGTGGCAGG - Intergenic
916297906 1:163240446-163240468 GACCATATGCATCAGGAGGCAGG + Intronic
916388016 1:164298908-164298930 GTACCTTTGAAGAAGGAGGCAGG + Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919458557 1:197848573-197848595 GTCCATATGCACAAGGACTCAGG + Intergenic
919853812 1:201692191-201692213 GTGGATATAGAGAAGCAGGCAGG + Intronic
920294149 1:204945679-204945701 GTGCATGTGCACAGGGAGGGAGG + Intronic
922083184 1:222318213-222318235 ATGCATGTGGAGAAGGAGGGCGG - Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
922618994 1:226979314-226979336 GTTCACAGGCAGAAGGCGGCAGG - Intronic
923774802 1:236968679-236968701 GTGAATATGAAGAAAGAGACCGG - Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067029777 10:42872318-42872340 GTGCAGAGGCAGCAGGCGGCAGG + Intergenic
1069752214 10:70751971-70751993 GGGCATAGGCAGAGGGAGGTGGG + Intronic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1071363317 10:84873409-84873431 GTGCACATGCAAGAGGAGCCAGG + Intergenic
1072083089 10:92052898-92052920 GGCCATAAGCAGGAGGAGGCAGG + Intronic
1073182604 10:101594095-101594117 GGAGATATGCAGAAGAAGGCAGG + Intronic
1074510825 10:114110427-114110449 GTGGACATGCAGTAGGAGCCTGG + Intergenic
1074532047 10:114304943-114304965 GTGCAGATGCAGGAGGGGACAGG + Intronic
1075395855 10:122126543-122126565 TTGCATATACAGAAGGTGGTTGG - Intronic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1076782803 10:132733717-132733739 GTTCACACGCAGAGGGAGGCCGG - Intronic
1077120895 11:907943-907965 GTGCCTCTGCAGAAGAAAGCAGG - Intronic
1077217180 11:1399795-1399817 GTGCCAAGGAAGAAGGAGGCTGG - Intronic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1078771950 11:14359210-14359232 CTGCATATGCATGAGGGGGCGGG + Intronic
1079127611 11:17730210-17730232 GTGCATATATGTAAGGAGGCTGG - Intergenic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079494287 11:21023756-21023778 GTGCACATGCAGGTGGGGGCTGG - Intronic
1079997744 11:27313500-27313522 GTGCATAGGCAGAAGGAAGGAGG + Intergenic
1081105197 11:39058512-39058534 GTGCAGATTCAGATGGAGGGAGG - Intergenic
1081463309 11:43291579-43291601 TGGCATATGCAGTAAGAGGCAGG + Intergenic
1081604321 11:44517918-44517940 GTGCATCTCCTGCAGGAGGCAGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087093981 11:94303021-94303043 GCGCATATGCAGGTGGAGGGAGG - Intergenic
1088344268 11:108805022-108805044 GGGCATTAGCACAAGGAGGCAGG + Intronic
1088576207 11:111274107-111274129 GTGCACATGCTGAAGGACCCTGG + Intronic
1089628955 11:119771549-119771571 GAGCATCTACACAAGGAGGCAGG + Intergenic
1089737043 11:120556709-120556731 GTGTATATGCAGGAGGTGACAGG - Intronic
1090155219 11:124430293-124430315 GTGCTTTCACAGAAGGAGGCTGG - Intergenic
1090210957 11:124920971-124920993 GAGCATGCGCAGACGGAGGCGGG - Exonic
1093627857 12:21371324-21371346 GTGAATATGAGGTAGGAGGCAGG - Intronic
1096240991 12:49960314-49960336 GGGCATGTGGAGAACGAGGCTGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097727654 12:63093292-63093314 GTGGATATGAAAAAGGAAGCAGG + Intergenic
1099002854 12:77201321-77201343 GTGGCTAGGGAGAAGGAGGCAGG + Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100861464 12:98811322-98811344 ATGGATGTGCAGAAGGAGTCTGG - Intronic
1101288262 12:103338780-103338802 GTGCATTTGCAGAAAGGGGTGGG + Intronic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1102563742 12:113780982-113781004 GTGCATATGCAGGGGAAGGAAGG - Intergenic
1102954218 12:117048924-117048946 GCGCCTCTGCAGCAGGAGGCTGG - Intronic
1103344782 12:120241964-120241986 GTGGATATGGAGAAGGAGTGAGG + Intronic
1104064520 12:125296218-125296240 GGGCATAGGCAGAAGGAGATGGG - Intronic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400655 12:128473287-128473309 GTGAAGATGAAGACGGAGGCTGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104400673 12:128473455-128473477 GTGCAGATGAAGACAGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104622892 12:130331624-130331646 GTGCGTATGCATGAGGAGGCGGG + Intergenic
1105809139 13:23979450-23979472 TTGCATATTCATAAGAAGGCGGG - Intergenic
1107424317 13:40277467-40277489 GTGCATATGGAGAATAATGCAGG - Intergenic
1107566351 13:41609277-41609299 AGGCATATGCAGAATGAGGTCGG - Intronic
1108615709 13:52129556-52129578 GTGCAAATCCAGAATGGGGCAGG - Intergenic
1110634680 13:77752858-77752880 GTGCCTATCCAGATGGAGGGTGG + Intronic
1112579722 13:100668143-100668165 GTGCATCTTCAGCAGCAGGCAGG - Intronic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1114715652 14:24821148-24821170 GTGAATATATGGAAGGAGGCAGG - Intronic
1115917250 14:38329708-38329730 GTGCTTATGAGGATGGAGGCTGG + Intergenic
1117843294 14:59883087-59883109 GTCCATAGACAGAAGGAGCCTGG - Intergenic
1117974531 14:61284058-61284080 GTGCAAAGGCAGGAGCAGGCTGG + Intronic
1118894009 14:69930824-69930846 TTGCATTTGCTGAAGTAGGCTGG + Intronic
1119813076 14:77540375-77540397 GTGCATATGCAGGAAGAGGAAGG + Intronic
1120560150 14:85981672-85981694 ATGCTTAAGCAGAAGGAAGCAGG - Intergenic
1121216616 14:92253460-92253482 GTGGAGATGCACAAGGAGTCAGG + Intergenic
1122420348 14:101572516-101572538 GTGCATATGGAGCAGGAGCCTGG - Intergenic
1122420371 14:101572672-101572694 GTGCATATGGAGCAGGAGCCGGG - Intergenic
1122741591 14:103874738-103874760 GGGTGTCTGCAGAAGGAGGCTGG + Intergenic
1122873612 14:104652552-104652574 CTCCATATGGAGAAGGATGCGGG - Intergenic
1122975401 14:105168810-105168832 CTGCATATGCATGAGGGGGCGGG + Exonic
1123126733 14:105952338-105952360 GGGCATATGCAGAGAGAGGCTGG - Intergenic
1123878634 15:24652446-24652468 GTGCAGATGTAGAAGTAGCCTGG + Intergenic
1124878957 15:33623849-33623871 GGGCATAGCCAGAGGGAGGCAGG - Exonic
1124887955 15:33704458-33704480 GTGTGTATGCAGGAGGTGGCTGG - Intronic
1125329393 15:38567070-38567092 ATGCATATGCAGTATAAGGCTGG - Intergenic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1128519174 15:68364428-68364450 GTGCATATCCCGAAGGAGGGAGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129291663 15:74572881-74572903 GTGATGATGCAGATGGAGGCCGG + Exonic
1130701002 15:86181517-86181539 GTACATATGGAGTAGGAGGGAGG + Intronic
1131668206 15:94592438-94592460 GTGCATGTGCACCAGGAGGCAGG - Intergenic
1134080745 16:11323375-11323397 GTGCAGATGGAGGTGGAGGCTGG + Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135522403 16:23187540-23187562 GTGCAGATGCAGATGGGGGTTGG - Intronic
1135775755 16:25256745-25256767 GTGCATTTGGAGAAAGAGACTGG - Exonic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137857431 16:51808876-51808898 GTGCACATGAAGAGGGAGGGAGG + Intergenic
1138462506 16:57159351-57159373 CTGCAAATGCAGAAGTTGGCAGG - Intronic
1140266326 16:73424423-73424445 GTACATATGCAGAAGGTGCAAGG - Intergenic
1141683058 16:85555282-85555304 GCGCCTGGGCAGAAGGAGGCAGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143013728 17:3880431-3880453 GGGCCTATGGAGAAGGATGCGGG + Exonic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1143484913 17:7248789-7248811 GTGCACATGGAGTAGGAGTCGGG + Intronic
1144603465 17:16640912-16640934 GTCCATATTCATAAGGATGCTGG - Intronic
1145839647 17:27983745-27983767 CTGCATATTGAGAAGGGGGCTGG + Intergenic
1150376956 17:64689326-64689348 GTGCTTGTGCATATGGAGGCTGG + Intergenic
1150462909 17:65367550-65367572 GTCCATGTGCACCAGGAGGCAGG + Intergenic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151699376 17:75734837-75734859 GTGCCTCTGGGGAAGGAGGCAGG + Intronic
1154507923 18:15060881-15060903 GTTCATGGGCAGAAGGGGGCAGG + Intergenic
1157443200 18:47725724-47725746 GTCCATGTGTATAAGGAGGCTGG - Intergenic
1157552163 18:48589366-48589388 GTACATGTGAAGATGGAGGCAGG - Intronic
1157924577 18:51749322-51749344 GGGGATATGGAGAAGGAAGCAGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1162576382 19:11501474-11501496 GGGGAAATGAAGAAGGAGGCTGG - Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1164502965 19:28834712-28834734 CTGCCTATGCAGCAGGTGGCTGG - Intergenic
1164549429 19:29196571-29196593 ATGCATATGCAGAAAGAGATTGG - Intergenic
1164820907 19:31250693-31250715 GTTCATTTGCAGAAGCCGGCTGG + Intergenic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167792807 19:51691608-51691630 GTCCTGATGCAGGAGGAGGCTGG + Intergenic
1202695162 1_KI270712v1_random:118170-118192 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
931696399 2:64873786-64873808 GTACACAGGCAGAAGCAGGCTGG - Intergenic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
932952327 2:76308797-76308819 GTGCTTATGCAGAAGCGGACTGG - Intergenic
934276332 2:91575219-91575241 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
934772644 2:96917108-96917130 GTGCACACGCAGACAGAGGCTGG + Intronic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
935420598 2:102865217-102865239 GTGCACATGGAGAAGGTGGTTGG + Intergenic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
936964771 2:118116865-118116887 ATGCATATGCAACATGAGGCAGG - Intergenic
937167733 2:119836834-119836856 GGGCCGAGGCAGAAGGAGGCTGG - Intronic
939348441 2:140999878-140999900 GTGCATCTGGAGAAGGTGACAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943298617 2:186169403-186169425 GAGCATTTGAAGAATGAGGCGGG + Intergenic
944939555 2:204608735-204608757 ATGCATATGCAGGAGCAGGGAGG - Intronic
945256080 2:207804369-207804391 GTGTGTGTGCAGAAGGAGACAGG + Intergenic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
946539402 2:220667008-220667030 GTCCATTTGCAGCAAGAGGCAGG + Intergenic
947633095 2:231666276-231666298 CTGCATGTGCAGCAGGAGGGAGG - Intergenic
948138962 2:235659069-235659091 GTGGACTTGCAAAAGGAGGCTGG - Intronic
948197512 2:236106633-236106655 ATGCATTTGGAGAAGGTGGCTGG + Intronic
948768958 2:240237679-240237701 GTGTAAATGCAGTAAGAGGCAGG - Intergenic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1170939013 20:20833309-20833331 GAGAATATGCAGGGGGAGGCGGG - Intergenic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1172570170 20:35964084-35964106 GTGGTTATGAGGAAGGAGGCTGG - Intronic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1175301842 20:57948530-57948552 GTGTATACTGAGAAGGAGGCTGG - Intergenic
1176790160 21:13310918-13310940 GTTCATGGGCAGAAGGGGGCAGG - Intergenic
1180136736 21:45866821-45866843 GTGCACATGCAGACGGGGGTGGG - Intronic
1180254021 21:46610233-46610255 GTGGACATGCAGAAGGAGCTGGG - Intergenic
1183231492 22:36584929-36584951 GAGCTTAGGCTGAAGGAGGCGGG - Intronic
1184821976 22:46916238-46916260 GTTCATCTTCAGCAGGAGGCTGG + Intronic
949614303 3:5737053-5737075 GAGCAAATGGAGAAGGATGCAGG + Intergenic
949807626 3:7973386-7973408 GAGCCTATGCTAAAGGAGGCTGG + Intergenic
951562480 3:23982283-23982305 GTTCCTGGGCAGAAGGAGGCGGG - Intergenic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
959949718 3:112165869-112165891 TGGCATCTGCAGAAGCAGGCAGG + Intronic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
961608278 3:128114668-128114690 GTGCAGATGCCTAATGAGGCAGG - Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964166791 3:153716810-153716832 GTGTGTATGCACAAGGAGGCAGG - Intergenic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
966223101 3:177569965-177569987 GGCCATGTGCAGATGGAGGCAGG - Intergenic
967860618 3:194148671-194148693 GTGCATGGGTAGAAGGAGGTGGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968405936 4:338917-338939 GTGCATGTGCAGAACCCGGCTGG - Intronic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
971146036 4:23977269-23977291 GTGCACATGCAGAGGAAGGTGGG - Intergenic
971255357 4:25009100-25009122 GTGCAGAGGCAGGAGGATGCAGG - Intronic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
972814991 4:42634717-42634739 TTGCATATGCATGAGGAGCCAGG - Intronic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
980135886 4:128858151-128858173 CTGGATATGCAAAAGCAGGCAGG - Intronic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983932990 4:173473622-173473644 GTGCATAAGGAAAAAGAGGCAGG + Intergenic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
985507868 5:294792-294814 GTCCATCGGCAGGAGGAGGCGGG + Intronic
985740168 5:1610879-1610901 GTCCATCGGCAGGAGGAGGCGGG - Intergenic
985938901 5:3118483-3118505 GGGCAACTGCAGAAGGAGGGTGG - Intergenic
986143708 5:5056579-5056601 GTGCCTCTGCTGATGGAGGCTGG + Intergenic
986912080 5:12570374-12570396 GTGAATGTGAAGATGGAGGCAGG + Intergenic
986934733 5:12868721-12868743 TTGCATATGTAGAGGAAGGCTGG - Intergenic
988658094 5:33234568-33234590 GGGCATATACACAAGGGGGCAGG + Intergenic
989094444 5:37768683-37768705 GTGCAAATGCAGTAGTAGGCAGG + Intergenic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
991201078 5:63993606-63993628 GTGCACATGTAACAGGAGGCAGG - Intergenic
991516170 5:67438006-67438028 GTACATCTGCAGAAGTAGGCTGG + Intergenic
992441780 5:76803414-76803436 GTGCACATGTAGCATGAGGCGGG + Intergenic
992935020 5:81693967-81693989 GTGCATATACAGAATGAAGTAGG + Intronic
993862784 5:93156757-93156779 GTTCATGAGCTGAAGGAGGCTGG - Intergenic
995037082 5:107546337-107546359 ATCCATAAGCAGAAAGAGGCTGG + Intronic
995739706 5:115342854-115342876 GTGGATATGCAGAAGGAGTGGGG + Intergenic
996349330 5:122520966-122520988 TTGCCTAATCAGAAGGAGGCAGG + Intergenic
997014500 5:129916787-129916809 GTGCATAAGAAGGAGGAGTCAGG + Intronic
997347571 5:133203053-133203075 GAGCATATGCAGAAGGCAGGAGG - Intronic
997679266 5:135737838-135737860 GTGCTGATGAAGTAGGAGGCTGG - Intergenic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
999627902 5:153539579-153539601 GTACATATGTAGAATGAGGTTGG + Intronic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1000550528 5:162656938-162656960 GTGCCTCTGCATAAGGAGACTGG - Intergenic
1000717851 5:164669064-164669086 GTGCATATGTAGTAGGTGGGTGG + Intergenic
1002604780 5:180376154-180376176 GTGCACATGCAGGTGGAGGATGG - Intergenic
1008507928 6:52248738-52248760 GTATATTTGGAGAAGGAGGCTGG - Intergenic
1012351821 6:98260822-98260844 GGGCATATGCAGAAGGAGAGAGG + Intergenic
1012382118 6:98632492-98632514 GTGCATATGGAGAGGGAAGCTGG - Intergenic
1016353802 6:143195725-143195747 GAGCACTTCCAGAAGGAGGCAGG + Intronic
1016453575 6:144209241-144209263 GTGAATGTGCACAGGGAGGCAGG - Intergenic
1016834301 6:148461982-148462004 GTGCATGTACAGGGGGAGGCAGG - Intronic
1018888971 6:167967221-167967243 TTGCTTATGCAGAATGATGCAGG - Intronic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1022293159 7:29022850-29022872 GTGCATATGCACTGGCAGGCTGG - Intronic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1023286569 7:38627245-38627267 GTAAAAATGCTGAAGGAGGCCGG + Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1028724208 7:94069350-94069372 GAGCATATGCAGTAGGGGGTGGG - Intergenic
1032320217 7:130879481-130879503 TAGCATATACAGAAGGATGCAGG - Intergenic
1033729664 7:144164227-144164249 GTGCATATTCAGATGTATGCAGG + Intergenic
1037980457 8:23249808-23249830 GAGCATGTGCAGCAGAAGGCAGG - Intronic
1038256881 8:25958416-25958438 GTGCAGATGGAGAAAGGGGCAGG - Intronic
1041094504 8:54335600-54335622 GTGCATACACAGAAACAGGCTGG + Intergenic
1043411346 8:80000048-80000070 GTGCATATGCAAATGGGGGAAGG - Intronic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1056618695 9:88191729-88191751 GTGCAGTTGAGGAAGGAGGCTGG - Intergenic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1058766416 9:108186826-108186848 GTGGAGATGCAGCTGGAGGCAGG - Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1062092787 9:134687277-134687299 GTGCCTTTGCATAAGGATGCAGG - Intronic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1185745945 X:2573529-2573551 GAGCATTTGCAGAGGGAGGGAGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1189699014 X:43696867-43696889 TTGCATATGCAGCACGTGGCAGG + Intronic
1190066062 X:47242523-47242545 GTGAGACTGCAGAAGGAGGCTGG + Intronic
1191074920 X:56442460-56442482 ATGCATATGCAGAAGGTGCAGGG - Intergenic
1193793099 X:85840867-85840889 GTGCATAGGCACCAGCAGGCTGG - Intergenic
1194321975 X:92460106-92460128 GTCAATATGCAGAACGATGCAGG - Intronic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1195576843 X:106460925-106460947 GAACATAAGCAGCAGGAGGCGGG - Intergenic
1196083415 X:111658486-111658508 GTATAAATGCAGAAGGATGCTGG + Intergenic
1196198017 X:112855576-112855598 GTGCATATTCAGCAGGTGGCAGG + Intergenic