ID: 1167040125

View in Genome Browser
Species Human (GRCh38)
Location 19:47019120-47019142
Sequence CTGCATGGAGAGAAGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167040115_1167040125 9 Left 1167040115 19:47019088-47019110 CCAGGGAGGACCCTGAGAACGGG No data
Right 1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG No data
1167040122_1167040125 -2 Left 1167040122 19:47019099-47019121 CCTGAGAACGGGAAGTGGGGGCT No data
Right 1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG No data
1167040110_1167040125 17 Left 1167040110 19:47019080-47019102 CCCCCATGCCAGGGAGGACCCTG No data
Right 1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG No data
1167040121_1167040125 -1 Left 1167040121 19:47019098-47019120 CCCTGAGAACGGGAAGTGGGGGC No data
Right 1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG No data
1167040112_1167040125 15 Left 1167040112 19:47019082-47019104 CCCATGCCAGGGAGGACCCTGAG No data
Right 1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG No data
1167040108_1167040125 25 Left 1167040108 19:47019072-47019094 CCTGGAGACCCCCATGCCAGGGA No data
Right 1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG No data
1167040113_1167040125 14 Left 1167040113 19:47019083-47019105 CCATGCCAGGGAGGACCCTGAGA No data
Right 1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG No data
1167040111_1167040125 16 Left 1167040111 19:47019081-47019103 CCCCATGCCAGGGAGGACCCTGA No data
Right 1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167040125 Original CRISPR CTGCATGGAGAGAAGGAGCT AGG Intergenic
No off target data available for this crispr