ID: 1167040618

View in Genome Browser
Species Human (GRCh38)
Location 19:47020828-47020850
Sequence CACCCTAGCCGGCCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167040618_1167040627 -1 Left 1167040618 19:47020828-47020850 CCAGCCCCGGGCCGGCTAGGGTG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1167040627 19:47020850-47020872 GGGAGCTGAGGCCTCCAGGTAGG 0: 1
1: 0
2: 6
3: 45
4: 414
1167040618_1167040626 -5 Left 1167040618 19:47020828-47020850 CCAGCCCCGGGCCGGCTAGGGTG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1167040626 19:47020846-47020868 GGGTGGGAGCTGAGGCCTCCAGG 0: 1
1: 0
2: 5
3: 89
4: 559
1167040618_1167040631 10 Left 1167040618 19:47020828-47020850 CCAGCCCCGGGCCGGCTAGGGTG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1167040631 19:47020861-47020883 CCTCCAGGTAGGGGAAACTGAGG 0: 1
1: 0
2: 3
3: 36
4: 298
1167040618_1167040633 21 Left 1167040618 19:47020828-47020850 CCAGCCCCGGGCCGGCTAGGGTG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1167040633 19:47020872-47020894 GGGAAACTGAGGCATCATCCAGG 0: 1
1: 0
2: 2
3: 28
4: 280
1167040618_1167040629 1 Left 1167040618 19:47020828-47020850 CCAGCCCCGGGCCGGCTAGGGTG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1167040629 19:47020852-47020874 GAGCTGAGGCCTCCAGGTAGGGG 0: 1
1: 1
2: 2
3: 35
4: 288
1167040618_1167040628 0 Left 1167040618 19:47020828-47020850 CCAGCCCCGGGCCGGCTAGGGTG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1167040628 19:47020851-47020873 GGAGCTGAGGCCTCCAGGTAGGG 0: 1
1: 1
2: 2
3: 23
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167040618 Original CRISPR CACCCTAGCCGGCCCGGGGC TGG (reversed) Intronic
900090136 1:916635-916657 CGCCCTGGCCGGCTCAGGGCCGG - Intergenic
900374660 1:2347981-2348003 CAGCACAGCCGTCCCGGGGCAGG + Intronic
900480114 1:2894141-2894163 CAGCCTAGCCTGCCCCTGGCAGG + Intergenic
900680311 1:3912781-3912803 AACCCTGGCCTGCCCTGGGCTGG + Intergenic
901525978 1:9823728-9823750 CAGCATCGCCAGCCCGGGGCGGG + Exonic
903008646 1:20315101-20315123 CAACCTAGGGGGCCAGGGGCTGG + Intronic
904028914 1:27521742-27521764 CACCCTCGCCGGCCAAGGGAAGG + Intergenic
904542065 1:31239811-31239833 CCCGCCAGCCGCCCCGGGGCAGG - Intergenic
909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG + Intergenic
915901967 1:159854242-159854264 AACCCTCCCCGGCCCTGGGCAGG + Intronic
924560552 1:245154356-245154378 CCCCCCGGCCGGCCCGGGGTCGG + Intergenic
1064014851 10:11763764-11763786 CACCATAGCTGGCCCGCTGCAGG - Exonic
1064562997 10:16611080-16611102 CACTCTAGCCAGCCGGGCGCTGG - Intronic
1069512568 10:69053228-69053250 CACCCTTCCTGGCCCTGGGCTGG - Intergenic
1071579685 10:86757245-86757267 CAGCCTCGCCGCTCCGGGGCGGG - Intronic
1072706122 10:97682272-97682294 CTCCCCAGCAGGCCTGGGGCTGG - Intronic
1073327102 10:102649477-102649499 CAGCCTGCTCGGCCCGGGGCAGG - Intronic
1075631465 10:124003227-124003249 CACGCCAGCCAGCCCAGGGCAGG + Intergenic
1076986103 11:236913-236935 CGCCGTAGCAGGCCGGGGGCGGG - Intronic
1077487590 11:2846153-2846175 CACCCTAGGCTGCGCCGGGCGGG - Intronic
1079004723 11:16783609-16783631 CACCCCAGCCAGCCCGGCCCAGG + Intronic
1080387319 11:31817771-31817793 GCCCCGAGCCGGGCCGGGGCCGG + Intronic
1080456950 11:32427163-32427185 CACACCAGCCCGCACGGGGCTGG - Intronic
1083748109 11:64746143-64746165 CAGCCTCGCTGGCCGGGGGCGGG - Intergenic
1084014879 11:66372175-66372197 AACCCGAGCCGGGCCCGGGCGGG + Intronic
1084225000 11:67710547-67710569 CACGCCAGCAGGCCCGGGGCTGG - Intergenic
1084262821 11:67990390-67990412 CACCCCAGCAGGCCCGGGGCTGG - Intergenic
1084810572 11:71608715-71608737 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
1096109546 12:49020742-49020764 CACCCAACCCGTCCAGGGGCTGG + Exonic
1097250532 12:57630224-57630246 CACCCTTGTCAGCCCAGGGCTGG - Exonic
1101999763 12:109550002-109550024 GTCCCTGGCCGGGCCGGGGCAGG + Intergenic
1103407494 12:120686531-120686553 CCCCTTAGCGGGCTCGGGGCGGG - Intergenic
1104387827 12:128366139-128366161 CTCCCTTCCCGGCCCTGGGCTGG - Intronic
1108484493 13:50910231-50910253 CCCACTACCCGGCCCGGCGCGGG + Intronic
1118971574 14:70642166-70642188 AACCCGAGCCCGCCCGCGGCCGG + Exonic
1122081572 14:99270896-99270918 CCCCCTCCCCGGCCCGGAGCCGG + Intronic
1122267001 14:100551226-100551248 CACCCTAGCAGGGCCGGGCCGGG - Intronic
1122933980 14:104947530-104947552 CACCCTTGTCGGCCAGGGACAGG + Exonic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1123963999 15:25438222-25438244 GACGCGAGCGGGCCCGGGGCGGG - Intronic
1124251244 15:28107518-28107540 GGCCCTGGCTGGCCCGGGGCTGG - Intergenic
1124556568 15:30731442-30731464 CACCCTGGCAGCCCCAGGGCTGG + Intronic
1124629386 15:31328027-31328049 CACCCGAGCGCGCCCGGGGAGGG - Intronic
1124952654 15:34337879-34337901 CACCCCGTCGGGCCCGGGGCTGG - Intronic
1125529784 15:40405696-40405718 CACCCTAGGCGGCCCGCCGAAGG - Intergenic
1125719057 15:41836387-41836409 CACCCCAGCCAGCCCTGGGCAGG - Intronic
1127606225 15:60591519-60591541 CTCCGTAGCCGGGCCGGGGGCGG - Intronic
1129238655 15:74239139-74239161 CACACTAGCTGGAGCGGGGCTGG - Intronic
1129846245 15:78768912-78768934 CACCCAAGCCAGCCCCGGGAAGG - Intronic
1130770225 15:86916774-86916796 AACACCAGCAGGCCCGGGGCTGG + Intronic
1131143788 15:89999343-89999365 CACCTTCGCCGGCACGGGGTAGG + Intergenic
1132656689 16:1044472-1044494 CCCCCCAGGCGGCCCCGGGCGGG - Intergenic
1134080013 16:11318686-11318708 CACCGTGGCTGGCCCAGGGCTGG + Intronic
1134441559 16:14302186-14302208 CCCTATGGCCGGCCCGGGGCGGG - Intergenic
1135143878 16:19944714-19944736 CACCATGCCCGGCCTGGGGCAGG + Intergenic
1139548162 16:67659480-67659502 CACCCCAGCCTGGCCGGCGCTGG - Intronic
1141132158 16:81444398-81444420 CACCCCCGCCGCCCCCGGGCCGG - Intergenic
1141423380 16:83931227-83931249 CACCCCAGCAAGCCCAGGGCAGG + Intronic
1141430489 16:83968421-83968443 CACCCCCGCCGGCCGGGCGCGGG - Intergenic
1141646354 16:85370069-85370091 CACCCTTGCGGGGCAGGGGCTGG + Intergenic
1143016307 17:3892859-3892881 CTCCCTTGCAGGCTCGGGGCAGG + Intronic
1143369011 17:6426810-6426832 CACCCTGGCCGGCACTGGGCAGG + Intronic
1147145498 17:38482289-38482311 CTCCCTGGGAGGCCCGGGGCAGG - Intronic
1148334463 17:46832276-46832298 CAGCTCAGCCGGCCCGGGGTGGG - Intronic
1148856459 17:50581596-50581618 TACCCCACCCCGCCCGGGGCTGG + Intronic
1149614444 17:57987282-57987304 CAGCCGGGCCGGCCCGGGGCAGG - Intronic
1151661591 17:75521878-75521900 CTCCCTGGCCGGGCCAGGGCTGG - Exonic
1151679540 17:75616196-75616218 CACCCTCCCTGGCCCGGGCCAGG - Intergenic
1152357399 17:79813720-79813742 GGCCCCCGCCGGCCCGGGGCGGG - Intergenic
1160404812 18:78638133-78638155 CGCCCCGGCCGGCCTGGGGCTGG + Intergenic
1160904578 19:1446235-1446257 CACCCTGGCCGCCGAGGGGCGGG + Intergenic
1161119365 19:2516939-2516961 CACCCCAGCAGGGCTGGGGCTGG + Intronic
1162032971 19:7925256-7925278 CCCCCTAGCCGGCCCTGCGCCGG - Exonic
1162888843 19:13717359-13717381 CACCTCACCCGGCCCAGGGCAGG - Intergenic
1162909895 19:13842968-13842990 CCCCCTGCCCGGCCCGGGGAGGG - Intergenic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1163596947 19:18225924-18225946 GACCCTCGCCGGCCTGGGGCAGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165900778 19:39168332-39168354 CACCCCAGCTGCCCCGGGCCTGG - Intronic
1166367169 19:42283822-42283844 GCCCCGAGCCGGCCGGGGGCGGG - Intronic
1167040618 19:47020828-47020850 CACCCTAGCCGGCCCGGGGCTGG - Intronic
1167907769 19:52676461-52676483 GAGGCTAGCCGGGCCGGGGCAGG - Intronic
929997467 2:46837657-46837679 TACCTTCGCCGGCCCTGGGCTGG + Intronic
931256858 2:60581695-60581717 CACCCCAGCTCGCGCGGGGCCGG + Intergenic
932621089 2:73265310-73265332 AGCCATAGCAGGCCCGGGGCGGG + Exonic
937276278 2:120686058-120686080 CAGCCTTGCCGGCACGGAGCAGG + Intergenic
938093173 2:128446536-128446558 CACCCATGCCGGCCCGAGGGTGG - Intergenic
938934508 2:136116855-136116877 CAGCCGCGGCGGCCCGGGGCTGG - Intronic
942098549 2:172556180-172556202 CGCCTTGGCCGGCCCGGGCCCGG + Exonic
942183818 2:173405546-173405568 CACCCTAGGTGGCCCAGGGGAGG + Intergenic
946200015 2:218065861-218065883 CACTCTAGCCGGCTCTGGCCAGG + Intronic
1168878136 20:1185186-1185208 CACCCTCGCCCGCCGGCGGCCGG - Intronic
1169318145 20:4609859-4609881 CTCCCTAGCAGGGCCAGGGCAGG - Intergenic
1169496784 20:6123088-6123110 AGACCTAGCAGGCCCGGGGCTGG - Exonic
1170572139 20:17638411-17638433 CACCCTTCCCAGCCCTGGGCAGG + Intronic
1171982527 20:31637989-31638011 CACCCAAGCCCGCGCGGGTCAGG + Intronic
1172118310 20:32584170-32584192 CCGCCCAGCCGGCCCGGGGGCGG + Intronic
1174401220 20:50276964-50276986 CATCCTAGCTGGACCAGGGCAGG - Intergenic
1175174222 20:57100951-57100973 CATCCTAGCAGTCCCAGGGCAGG + Intergenic
1175724732 20:61310144-61310166 CACCCCAGCTGGCTCTGGGCTGG - Intronic
1175806016 20:61829867-61829889 CACCCCAGCAGGCTAGGGGCGGG - Intronic
1176382003 21:6118344-6118366 CTGCCTGGCAGGCCCGGGGCGGG - Exonic
1178924915 21:36766797-36766819 CACCCCAGCTGGCCCTGGGCTGG - Intronic
1179457306 21:41508243-41508265 CACCCTGGGCGGGCGGGGGCGGG + Intronic
1179741469 21:43419895-43419917 CTGCCTGGCAGGCCCGGGGCGGG + Exonic
1181512984 22:23397103-23397125 CACCGCAGCCAGGCCGGGGCTGG + Intergenic
1181745441 22:24952669-24952691 CAGCCTAGCCTGCTGGGGGCGGG - Intergenic
1183924686 22:41197469-41197491 CACCCTAGAGGGCGCCGGGCGGG + Intergenic
1184184697 22:42856956-42856978 CAGCCTGGCCGGGCCGGGGCGGG - Intronic
1185374368 22:50475228-50475250 CACCACAGCCGACCCGGGTCAGG - Intergenic
949105452 3:196988-197010 CCCCCGAGCCGGCCGGGAGCCGG - Exonic
949508881 3:4751385-4751407 CACCCTGGCCGGCCTGGTGGTGG + Intronic
954814507 3:53270136-53270158 CACCCTAGAAGGCCTGGGGCTGG + Intergenic
957078258 3:75618332-75618354 CACCCCAGCACGCCCGGGGCTGG - Intergenic
958982880 3:100744852-100744874 CACCATAGCCGGCCTGTTGCTGG - Exonic
961504238 3:127359633-127359655 CACCCCAGCAAGCCAGGGGCTGG + Intergenic
961637499 3:128342525-128342547 CACCCTAGGTAGCCAGGGGCTGG - Intronic
963081842 3:141402236-141402258 CAGCCCCGCGGGCCCGGGGCTGG - Intronic
964302151 3:155300560-155300582 CACCTTAGCCTCCCCGTGGCTGG - Intergenic
964437911 3:156674071-156674093 CAGCCTGTCCGGCTCGGGGCAGG + Intronic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
967924245 3:194633569-194633591 CATCCTGGCCGGAGCGGGGCGGG + Intronic
968603320 4:1520579-1520601 CACCCTGGACAGGCCGGGGCTGG - Intergenic
968654211 4:1771690-1771712 CACCCCAGCCGGCCCGATGCTGG + Intergenic
969021329 4:4142305-4142327 CACCCCAGCAGGCCCAGGGCTGG - Intergenic
969732534 4:8965111-8965133 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
969792113 4:9499194-9499216 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
983814360 4:172104229-172104251 CACCGTGCCCGGCCTGGGGCAGG + Intronic
985014899 4:185623705-185623727 CAGCCTCGCCGGCCCCGAGCGGG + Exonic
985595049 5:784296-784318 GACCCTGCCCAGCCCGGGGCTGG - Intergenic
985616690 5:927081-927103 CACCCTGCCTGGCCTGGGGCGGG - Intergenic
987251888 5:16108623-16108645 CGCCCCAGCTGGCCTGGGGCAGG + Intronic
992739790 5:79762228-79762250 CACCCAAGTTGGCCTGGGGCAGG + Intronic
998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG + Exonic
1002000118 5:176192602-176192624 CCCCCTAGAGAGCCCGGGGCAGG - Intergenic
1009975580 6:70667787-70667809 CACCCTAGCCGGCGAGGGGAGGG - Exonic
1017590945 6:155977319-155977341 CACCATACCCGGCCCTAGGCAGG + Intergenic
1018393028 6:163355157-163355179 CAGCCTGGCCGGCCCCTGGCAGG + Intergenic
1019348627 7:542878-542900 CCCCCAAGCAGGCCAGGGGCAGG + Intergenic
1020308751 7:6854334-6854356 CACCCCAGCAGGCCCGGGGCCGG - Intergenic
1022088138 7:27088404-27088426 CAGCCTAGCCGGCCGGGGGCAGG + Intergenic
1023038362 7:36152740-36152762 CGCCCTCGCCGGCACGGCGCCGG + Intergenic
1026805015 7:73424066-73424088 CTCCCGGCCCGGCCCGGGGCTGG + Intergenic
1026821956 7:73556031-73556053 CAGCCTAGCCTGCTAGGGGCGGG + Intronic
1027390182 7:77696420-77696442 TCCGCTAGCCGGCGCGGGGCAGG - Intergenic
1027539599 7:79452306-79452328 ACCCCTAGCCAGCCCGGGGGAGG - Intronic
1030135087 7:106238963-106238985 CACCCTAGCCTGCCTGGGGAAGG - Intergenic
1030278424 7:107744215-107744237 CCCCTTGGCCGGCCTGGGGCTGG + Intronic
1031302973 7:120086674-120086696 CACCCTGCCCGGCCCCGGTCTGG - Intergenic
1034469849 7:151249219-151249241 CACCGCCGCCGGCCCCGGGCAGG - Intronic
1037876950 8:22553044-22553066 CACCCTCGCTAGCCCTGGGCAGG + Intronic
1040567615 8:48581867-48581889 CATCCCAGCCAGCTCGGGGCGGG - Intergenic
1041847012 8:62340710-62340732 CACCCTAGCCTGCCCTCAGCAGG - Intronic
1047642418 8:126834623-126834645 CACCGTACCCGGCCCGGAACTGG - Intergenic
1049689578 8:143952797-143952819 CCCCCAAGCCGGCTCCGGGCAGG + Intronic
1058908202 9:109498182-109498204 GACCCCAGCGGGCCGGGGGCAGG - Intronic
1060139835 9:121201061-121201083 CAGCCGGGCCGGGCCGGGGCCGG - Intronic
1061196940 9:129111652-129111674 CACCCTACCCGACCCCGGCCCGG - Intronic
1061361306 9:130144038-130144060 CACTCTAGCCAGACCGTGGCAGG - Intergenic
1061479241 9:130888457-130888479 AACTCCAGCCGGGCCGGGGCTGG + Intergenic
1062136487 9:134931172-134931194 CACCCCGCCCGGCCCGGTGCTGG + Intergenic
1062173420 9:135147930-135147952 CAGCATAGCTGGCCCAGGGCAGG + Intergenic