ID: 1167041187

View in Genome Browser
Species Human (GRCh38)
Location 19:47023332-47023354
Sequence TCCGGGGCTCAGAGGCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 158}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167041184_1167041187 -10 Left 1167041184 19:47023319-47023341 CCTGGATGAGCATTCCGGGGCTC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041176_1167041187 0 Left 1167041176 19:47023309-47023331 CCCCCCATTACCTGGATGAGCAT 0: 1
1: 0
2: 1
3: 14
4: 126
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041179_1167041187 -3 Left 1167041179 19:47023312-47023334 CCCATTACCTGGATGAGCATTCC 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041171_1167041187 16 Left 1167041171 19:47023293-47023315 CCCCGGCGGCGTCCAGCCCCCCA 0: 1
1: 0
2: 1
3: 9
4: 190
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041175_1167041187 4 Left 1167041175 19:47023305-47023327 CCAGCCCCCCATTACCTGGATGA 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041173_1167041187 14 Left 1167041173 19:47023295-47023317 CCGGCGGCGTCCAGCCCCCCATT 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041172_1167041187 15 Left 1167041172 19:47023294-47023316 CCCGGCGGCGTCCAGCCCCCCAT 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041180_1167041187 -4 Left 1167041180 19:47023313-47023335 CCATTACCTGGATGAGCATTCCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041178_1167041187 -2 Left 1167041178 19:47023311-47023333 CCCCATTACCTGGATGAGCATTC 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1167041177_1167041187 -1 Left 1167041177 19:47023310-47023332 CCCCCATTACCTGGATGAGCATT 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167041187 Original CRISPR TCCGGGGCTCAGAGGCATCA GGG Intronic
900310124 1:2029470-2029492 TCCGTGGGTCACAGGCATCAAGG + Intronic
900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG + Intronic
900625560 1:3607055-3607077 TCCGGGGCTTGGAGACATCAGGG + Intronic
901188273 1:7388849-7388871 TGGAGGGCTCAGAGGCCTCAGGG - Intronic
905581755 1:39087691-39087713 TCCGAGGCTCAGAGGGTTTAGGG + Intronic
906702015 1:47866524-47866546 TCAGTGGTTCAGAAGCATCAAGG - Intronic
912454612 1:109789180-109789202 GCCGGGGAGCAGAGGCCTCATGG - Intergenic
912693186 1:111819933-111819955 TCCGGGGCAGGGAGGGATCAGGG - Intronic
915410443 1:155697516-155697538 TTTGCGGCTCAGGGGCATCATGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917978625 1:180255886-180255908 TCTGGGGATCAGATGCATCTGGG + Intronic
918514105 1:185343560-185343582 TACGGGGCTCAGATGCATGATGG - Intergenic
920113733 1:203604894-203604916 ACCGAGGCTCAGAGGTTTCATGG - Intergenic
921882190 1:220267913-220267935 TCCTTGGGTCATAGGCATCACGG - Intronic
924706540 1:246507137-246507159 TCCGGGGCGCAGCGGGGTCACGG + Exonic
1064353305 10:14596402-14596424 TCTGGGGATCAGTGGGATCACGG - Intronic
1069072791 10:64006996-64007018 TTTGCGGCTCAGGGGCATCATGG - Intergenic
1069683541 10:70301576-70301598 TCAGGTGCTCAGAGTCCTCATGG - Intronic
1072668742 10:97413765-97413787 TACGAGGCTCAGAGGCATGGAGG + Intronic
1074211713 10:111341302-111341324 TTTGCGGCTCAGGGGCATCACGG - Intergenic
1075145873 10:119882669-119882691 TCAGGGGCTCAGATCCCTCATGG - Intronic
1075495132 10:122913474-122913496 TCCTGAGCTCAGTGGCCTCAAGG + Intergenic
1076209449 10:128628758-128628780 TCATGGGCCCAGAGGCATCTGGG - Intergenic
1076356758 10:129858756-129858778 TCCAGGCCTCAGAGGCTCCAGGG + Intronic
1077367822 11:2168268-2168290 TCCGGGGGGCAGAGGCAGCCGGG + Intronic
1079009455 11:16816339-16816361 TCTGGGGCTCAGAGGGGACATGG - Intronic
1080573314 11:33576714-33576736 AGCGGGGCTCAGAGGAATCAAGG + Intronic
1081645782 11:44789452-44789474 ACTGGGGCTCAGAGACATTAAGG - Intronic
1084321060 11:68373559-68373581 GCCGGGGCTCAGTGGGACCATGG + Intronic
1084459119 11:69286450-69286472 TCCGGGGTTCAGAGGATTCAAGG + Intergenic
1085317451 11:75554215-75554237 ACTGAGGCTCAGAGGGATCAGGG + Intergenic
1088982336 11:114875034-114875056 TCTGGGGCCCAGAGGCTCCATGG - Intergenic
1090819302 11:130326645-130326667 TCCGGCGCTGAGTGGCAGCATGG - Intergenic
1093201961 12:16198904-16198926 TGTGAGGCTCAAAGGCATCAAGG - Intronic
1095927219 12:47591209-47591231 CCTGAGGCTCAGAGGCATCAGGG - Intergenic
1097847931 12:64385491-64385513 GCTGGGGCTCAGAGGCATAAAGG + Intronic
1102899417 12:116624836-116624858 TCTGAGGCTCACAGACATCACGG - Intergenic
1103921820 12:124403196-124403218 TCCTGGGCTCTGGGGAATCAGGG - Intronic
1104351681 12:128049514-128049536 TCCAGGACTCAGATGTATCATGG + Intergenic
1105063117 12:133172296-133172318 TCCAGGGCTCAGGAGGATCAAGG - Intronic
1116856243 14:49954929-49954951 TCAGGGGCTTAGGGACATCATGG + Intergenic
1119259380 14:73228455-73228477 CACCGGGCTCGGAGGCATCAGGG - Intergenic
1119810231 14:77511811-77511833 TCCAGGTCTCAGAGGTCTCAAGG - Exonic
1120187552 14:81410145-81410167 TCAGTGGCTCAGTGACATCAGGG - Intronic
1122796184 14:104207368-104207390 TCCGGGGTGCCGAGGCAGCAGGG - Intergenic
1123001057 14:105294283-105294305 GCCTGGGCTCAGAGGCGTCTTGG + Intronic
1123781306 15:23631685-23631707 TTTGGGACTCAGAGGCTTCATGG - Intergenic
1123931910 15:25176002-25176024 TCCATGGCTCAGAAGCAGCATGG - Intergenic
1123933591 15:25183476-25183498 TCCATGGCTCAGAAGCAGCATGG - Intergenic
1127287305 15:57543104-57543126 TACTGGTCTCAGAGGCAGCATGG - Intronic
1128359657 15:66953108-66953130 CCCGGGGCTCAGAAGCAGCCTGG - Intergenic
1128498650 15:68212029-68212051 TCCGGGGTTCATAGGGGTCACGG - Intronic
1129035318 15:72645481-72645503 TACGTGGCTCAGAGTCACCATGG + Intergenic
1129214566 15:74091735-74091757 TACGTGGCTCAGAGTCACCATGG - Intergenic
1129676613 15:77635125-77635147 TCCGCGCCTCGGAGGCAGCAGGG + Intronic
1130519809 15:84653863-84653885 ACCGAGGCTCAGGGACATCAAGG - Intronic
1131830688 15:96352875-96352897 TCCAGGGCTCAGAGGGAGCGAGG - Intergenic
1132989411 16:2785340-2785362 GGCGGGGCTCCGAGGCATCCGGG - Intronic
1134057947 16:11182031-11182053 CCCGAGGCTCAGAGGCATCGAGG - Exonic
1135114094 16:19711262-19711284 TCCTGGTCTCAGGGGCACCAGGG - Intronic
1135994244 16:27236221-27236243 TCCAGTGCTCAGAGGCTTCCTGG - Intronic
1136022630 16:27449702-27449724 TCCGGGGCTTTGTGGGATCAGGG + Exonic
1136414539 16:30095561-30095583 TCCGGGGACCAGAGGCGTCTCGG + Exonic
1137715527 16:50595990-50596012 TCGGGGGCTCAGGGGGAGCAGGG - Intronic
1138110367 16:54319009-54319031 TCACTGGTTCAGAGGCATCAGGG + Intergenic
1138314311 16:56055486-56055508 ACCGGGGCTCAGAAACACCAAGG - Intergenic
1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG + Intergenic
1140567468 16:76060891-76060913 CCAGGGGCTCAGAGCCCTCAAGG + Intergenic
1141439530 16:84020715-84020737 TCACAGGCTCAGAGGCCTCAAGG - Intronic
1142700410 17:1656445-1656467 TCTGGGGCTCAGTGGCTTTAAGG + Exonic
1142720858 17:1774920-1774942 TCAGGGGCTCTGAGGCCTCAGGG - Intronic
1143490007 17:7280928-7280950 TCAGAGGCTCAGAGACCTCAGGG + Intergenic
1143667204 17:8370346-8370368 TCCAGCTCTCTGAGGCATCATGG + Exonic
1145985498 17:29043207-29043229 TGTGGGGCTGAGTGGCATCATGG + Exonic
1146579629 17:34025174-34025196 TCAGGGGCTCAGAAGGAACAAGG - Intronic
1146685518 17:34838940-34838962 TCTGGGGCTCAGAGTCTTCCTGG - Intergenic
1147306637 17:39568751-39568773 GTGGGGGCTCAGAGGCATGAAGG - Intergenic
1147660501 17:42114532-42114554 CCCGGGGCTCAGCTGCTTCAAGG - Exonic
1149845227 17:60005376-60005398 TCCGGGGCTCCTAGGCCTGATGG + Intergenic
1152765316 17:82134150-82134172 TCCGGGCCTCAGGGGCAGGAGGG + Intronic
1152876656 17:82790294-82790316 TCAAGGGCACAGAGGCAGCATGG - Intronic
1153449019 18:5205919-5205941 TCCAGAGCTCTGAGGGATCAGGG - Intergenic
1154425827 18:14271365-14271387 TCAGGGGCTCATAGGCAGAAGGG + Intergenic
1155162736 18:23208782-23208804 CCTGGGGCTCAGAGGGAACATGG - Intronic
1156484405 18:37455842-37455864 TCTGGCCCTCAGTGGCATCAGGG - Intronic
1159799830 18:72884304-72884326 TCCTGGGCTCTGGGTCATCATGG - Intergenic
1163619226 19:18348216-18348238 TCCGGGGCTCGGGGCCATCTGGG + Intronic
1163845419 19:19635720-19635742 GCCTGGGGTCAGAGGAATCATGG + Exonic
1164633696 19:29777831-29777853 TCCCTGTCTCAGAAGCATCAGGG + Intergenic
1164918627 19:32071978-32072000 TCCTGAGCTCAGAGGCACCAGGG - Intergenic
1165685444 19:37816070-37816092 TTTGCGGCTCAGGGGCATCACGG + Intronic
1165741142 19:38206009-38206031 GCCAGGGCTCACAGGCCTCAGGG + Intronic
1166392026 19:42413712-42413734 TGAGGGGCTCTGAGGCCTCAGGG + Intronic
1166984670 19:46652693-46652715 CCCGGGGCTCAGAGGGACCCAGG + Exonic
1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG + Intronic
1167088203 19:47324743-47324765 TCCAGGACTTAGAGGCATCCCGG - Intergenic
1168122919 19:54264281-54264303 TCAGGTGCTCAGATGCCTCAAGG - Intronic
926858676 2:17284809-17284831 TCCGGGGATCACTGGCACCAAGG - Intergenic
929464605 2:42133357-42133379 TCCCGGGCTCACAGGCTACACGG + Intergenic
932413875 2:71562374-71562396 CCTGGGGTTCAGAGGCATCCAGG - Intronic
933138717 2:78767153-78767175 TCTGAGGCTCAGAGACTTCATGG + Intergenic
934093315 2:88574254-88574276 TCCAGGGCTCTGAAGCAGCATGG - Intronic
935955616 2:108373911-108373933 TTTGCGGCTCAGGGGCATCAAGG + Intergenic
937039822 2:118812705-118812727 TCCTGGGCTCAGGGGCATCCTGG - Intergenic
941376476 2:164737353-164737375 TCCTGGGCTCAGAGCCATGGGGG + Intronic
944395385 2:199260669-199260691 TCCGGGTTTCAGAGGCAGCAGGG + Intergenic
946202608 2:218079666-218079688 TCCCTGGCTCCCAGGCATCAGGG - Intronic
1168765794 20:381114-381136 GCCGGGGCTCAGAGCCTCCAGGG - Exonic
1169795426 20:9457736-9457758 TGCCTGCCTCAGAGGCATCAAGG + Intronic
1170486263 20:16819178-16819200 TCAGGTGCTGAGAGACATCATGG + Intergenic
1171192198 20:23166635-23166657 CCCGGGCCTCAGAGGCATCCTGG + Intergenic
1171475847 20:25407986-25408008 TCCGGAGCTCGGAGGGAACAAGG - Intronic
1172562972 20:35905773-35905795 GCAAGGGTTCAGAGGCATCAAGG + Intronic
1174285385 20:49469080-49469102 TCTGGGGCTCAGAGGCTCCCAGG + Intronic
1179643917 21:42763942-42763964 GACGGGGCCCTGAGGCATCACGG + Intronic
1181161605 22:20963171-20963193 CCCGGGGCTCAGAGCCCTCCTGG + Intergenic
1181979053 22:26753108-26753130 ACTGGGGCTCAGAGACATTAGGG + Intergenic
1183184551 22:36284595-36284617 CCCGGGGCTCACTGGCATCTAGG + Intronic
952831640 3:37570109-37570131 GCCGGGGCTCTGAGGGATCAAGG - Intronic
953032021 3:39185584-39185606 TCAGGGGCTCAGAGGCTTGCTGG + Exonic
953563970 3:44015313-44015335 TCTGGGTCTCCGAGGCAACATGG - Intergenic
954105421 3:48407214-48407236 TCCGGGACTCAGGGGCTTCCTGG - Intronic
956732947 3:72213660-72213682 TCCGGGGGTCAGAGCCAAAATGG + Intergenic
958865745 3:99499601-99499623 TCAGTAGCTCAGTGGCATCAGGG + Intergenic
963733236 3:148992008-148992030 TCCGGGGCGCAGCGGCATCGTGG + Intronic
965342234 3:167504337-167504359 TCCAGGGCACAGTGGCACCAGGG - Intronic
967835236 3:193956833-193956855 GCCAGGGCTCAGAGGCAACGTGG - Intergenic
968502843 4:959198-959220 TCGGGGGATTAGTGGCATCAAGG + Exonic
968518303 4:1023962-1023984 TCCTGGGCTCAGCGGCCTCTGGG - Exonic
968812675 4:2807054-2807076 TTCGGGGCTCAGAGGCCCCAGGG - Intronic
969154774 4:5200923-5200945 TGAGGGGCTCAGTGGCTTCAAGG - Intronic
969606324 4:8203991-8204013 TCCGGGCCTCAGAGCCCTGATGG - Intronic
976108753 4:81647569-81647591 TCAGTGGCTCAAAGACATCAAGG - Intronic
990211371 5:53483566-53483588 TCCGGGGCGCAGACGCAGCGGGG - Exonic
995788400 5:115856545-115856567 TCCAGGGCTCAAGGGCCTCAAGG + Intronic
998333781 5:141352282-141352304 TCTGGGGGTCAGAGGGCTCAGGG - Exonic
1002423838 5:179164447-179164469 GCAGGAGCTGAGAGGCATCAGGG + Intronic
1002714661 5:181219487-181219509 TCGGGGTCACAGAGGCAGCAAGG - Intergenic
1002942215 6:1727551-1727573 TCTCGGGGTCAGAGTCATCATGG + Intronic
1004191766 6:13470391-13470413 TCCAGGGCACAGAGGCAGCCTGG - Intronic
1012235631 6:96811182-96811204 TCCTGGGATCAGTGGAATCAAGG - Intronic
1016199832 6:141394396-141394418 CCTGGGGCTCAGAGGCACCCCGG - Intergenic
1019279348 7:192394-192416 CCCGGAGCTCAGAGGCGTCGCGG + Intergenic
1020070998 7:5227007-5227029 TCAGGGCCCCAGGGGCATCACGG - Intronic
1025014890 7:55431259-55431281 TCCTGGGACCAGAGACATCACGG + Exonic
1026898340 7:74023317-74023339 CCCGGGGCTAAGAGGAAACACGG + Intergenic
1029605319 7:101595487-101595509 TCTGGGGCTCAGAGCAATCAGGG - Intergenic
1034445480 7:151111810-151111832 TCAGGGGCTGAGAGGCTCCATGG - Intronic
1036146992 8:6263278-6263300 ACCGGGTCTCAGAGGCAAGAGGG + Intergenic
1036744107 8:11391746-11391768 TCCGGGTCTCAGAAGCGTAAGGG + Intronic
1037806273 8:22059394-22059416 TCCGGGCCACACAGGCAGCAGGG - Exonic
1038479721 8:27893506-27893528 TCCAGGGTTCAGGGGCATCTGGG - Intronic
1042228483 8:66533916-66533938 TCCCTGTCTCAGAGGCATCCAGG + Intergenic
1044951803 8:97442524-97442546 ACCTGGGCTCAGAGGAATGAGGG - Intergenic
1049529794 8:143148471-143148493 GCTGGGGCTCAAAGGCATTAAGG + Intergenic
1049594816 8:143478363-143478385 CCCGTGGGGCAGAGGCATCAGGG + Intronic
1051153461 9:14112919-14112941 TCCGGATCTGAGAGGCAACATGG + Intronic
1052879610 9:33593269-33593291 TCAGAGGCTCAGAGGCAGAAGGG + Intergenic
1053496371 9:38550963-38550985 TCAGAGGCTCAGAGGCAGAAGGG - Intronic
1054848843 9:69825546-69825568 TCTCTGGCTCAGAAGCATCAAGG - Intronic
1057191667 9:93091781-93091803 GCTGGGTCACAGAGGCATCATGG - Intergenic
1059528696 9:115016360-115016382 TCTGGGGCACAGAGGCTGCATGG + Intergenic
1059755285 9:117287962-117287984 ACTGAGGCTCAGAGGCATGAAGG + Intronic
1061858796 9:133457309-133457331 TCTGGGGCTTAGTGGCAACAGGG + Intronic
1062032042 9:134366134-134366156 GCCAAGGCTCAGAGGCACCAGGG + Intronic
1062527539 9:136984402-136984424 CCCTGGGCTCAGAGACAGCAAGG + Intronic
1062711117 9:137975669-137975691 TCTGGGTCTCAGAGGCACTAGGG + Intronic
1185449803 X:276073-276095 TCAGGGGCTTAGAGACAGCAAGG - Intergenic
1190437061 X:50435941-50435963 TCCTCTGCTCAGAGGCAGCAAGG - Intronic
1196685735 X:118508932-118508954 CCCTAGGCTCAGAGACATCAGGG + Intronic
1196944292 X:120808782-120808804 TTTGTGGCTCAGGGGCATCATGG + Intergenic
1199506908 X:148573273-148573295 TCAGGGTCCCAGAGGCTTCATGG - Intronic
1200256420 X:154585340-154585362 CCCGGGGCGCAGGGGCAGCAAGG + Exonic
1200261349 X:154619063-154619085 CCCGGGGCGCAGGGGCAGCAAGG - Exonic
1200267332 X:154653360-154653382 CCCGGGGCGCAGGGGCAGCAAGG - Exonic
1201892657 Y:18959387-18959409 TTTGTGGCTCAGGGGCATCATGG + Intergenic