ID: 1167041478

View in Genome Browser
Species Human (GRCh38)
Location 19:47025248-47025270
Sequence CTGTGGCAGTTGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167041472_1167041478 27 Left 1167041472 19:47025198-47025220 CCTGGAGTAGCATCTGGGACACA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG 0: 1
1: 0
2: 4
3: 52
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167041478 Original CRISPR CTGTGGCAGTTGAGGGAAGG AGG Intronic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900485017 1:2918520-2918542 CTGTGACATTTGGGGGCAGGCGG + Intergenic
900967540 1:5969341-5969363 CTGTGGCACGTGTAGGAAGGCGG - Intronic
901181772 1:7346909-7346931 CTGTGACAGTTGAGTGTAGCTGG - Intronic
901456528 1:9366223-9366245 CTGGGGCAGTTGCGGGGAGAAGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901746957 1:11380183-11380205 CTGTGGCAGATGGTGGAAGACGG + Intergenic
902348454 1:15836024-15836046 CCTTGGCCTTTGAGGGAAGGGGG + Intergenic
902677149 1:18016650-18016672 TTGTGGCAGTAGAAGAAAGGTGG + Intergenic
902719006 1:18291857-18291879 CTGTGGCAGGTGACGGATGGTGG + Exonic
903359456 1:22767673-22767695 CTGGGCCAGTGGTGGGAAGGAGG - Intronic
903446675 1:23426758-23426780 CAGTGGCCGTTGAGGGGAGGAGG + Intergenic
903483731 1:23674138-23674160 CTTTGACAGGTGGGGGAAGGGGG - Intergenic
904163446 1:28537683-28537705 CTCTGGGAGTTCAGGGAAGTTGG - Intronic
904503950 1:30935605-30935627 CAGTGGCAGTTGAAGGCTGGGGG - Intronic
905203629 1:36330365-36330387 CTTTGGCAGGTTTGGGAAGGGGG - Intergenic
906468698 1:46108715-46108737 CTGTGCTAGCTCAGGGAAGGAGG - Intronic
907280805 1:53346046-53346068 CTGGGGCTGCTGAGGCAAGGAGG + Intergenic
907794026 1:57696329-57696351 CTGTGGGAGATGTGGGAAGCAGG + Intronic
908840770 1:68278040-68278062 CTGTGTCAGCTGAGAGAGGGAGG - Intergenic
909659290 1:78064380-78064402 CACTGGCATTTGAGGGAAGCAGG - Intronic
909881082 1:80879651-80879673 CTATGGGGGTTGAGGGATGGAGG - Intergenic
910337911 1:86155334-86155356 CCGTGTCAGCTGAGGGCAGGCGG - Intronic
911099664 1:94085051-94085073 CTGTAGCAATTGGGGGAAAGTGG + Intronic
912475031 1:109929570-109929592 CTCTGGCAGGTGCTGGAAGGAGG - Exonic
912946347 1:114087836-114087858 GTGTGGAAGTTGTGGGGAGGAGG - Intergenic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
915073355 1:153290267-153290289 CTGTGACTGCTGAGGGAAAGAGG - Intergenic
915277736 1:154801113-154801135 CTGGGGGAGATGAGGAAAGGAGG + Intronic
915292882 1:154898095-154898117 GTGTGGGAGTTGTGGGGAGGAGG - Intergenic
915544087 1:156586134-156586156 CTGTTGAAGTTGGGGGAAGCTGG + Intronic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916732949 1:167582647-167582669 CTGTGGCAGATGGTGGAAGAGGG - Intergenic
917452398 1:175157935-175157957 CAGTGGCAGTTCAGGGACAGAGG + Intronic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
918082616 1:181219010-181219032 CTGTGGCCGGTGGGGGATGGTGG + Intergenic
918265732 1:182839757-182839779 CCGCGGCGGCTGAGGGAAGGGGG + Intronic
918533765 1:185551657-185551679 CTTTGGGAGGTGAGGGAGGGTGG + Intergenic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920385538 1:205568599-205568621 CTGTGGCAGTGGAGGAAACCCGG - Intergenic
920660818 1:207912718-207912740 CTGAGGAAGTTGAGGGGAGTGGG - Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
921487657 1:215733954-215733976 CTGTTGGAGCTGTGGGAAGGGGG - Intronic
1063306744 10:4909700-4909722 CTGTGGCCATTGAGGTAGGGTGG - Intergenic
1063885071 10:10569070-10569092 CTATGGCAGTGGAAGAAAGGGGG + Intergenic
1064014273 10:11760668-11760690 CTGTGTCAGTGGAGGGTAAGTGG + Intronic
1064618689 10:17191979-17192001 CAGTGTCAGATGAGGCAAGGTGG + Intronic
1065823696 10:29550692-29550714 CCGTGGCACTTCAGTGAAGGAGG + Exonic
1066223059 10:33355015-33355037 ATGTGGCAGTTAAGGGAAGGAGG - Intergenic
1067442617 10:46318092-46318114 CTGGGGCAGAGGAGGGGAGGTGG + Intronic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067879182 10:50029047-50029069 GTGTGGGAGTTGTGGGGAGGAGG + Intergenic
1068931058 10:62590754-62590776 CAGTGACAGTTGAGGGAACAAGG - Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069652161 10:70057237-70057259 TTGCAGCAGTTGAGGTAAGGGGG + Intronic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070793558 10:79203863-79203885 CCGGGGCAGGTGAGGGAGGGTGG - Intronic
1070925789 10:80220716-80220738 CTCTGGCAGATGTGGGATGGAGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1073125053 10:101144020-101144042 GTGTAGAAGGTGAGGGAAGGAGG - Intergenic
1075163401 10:120044214-120044236 CTGGAGCTGTTGAGGGAGGGTGG - Intergenic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1075679254 10:124320827-124320849 CTGTGCCTGCTGAGTGAAGGTGG + Intergenic
1076053774 10:127355009-127355031 CTGAGGCAACTGAGGGAGGGAGG - Intronic
1076431903 10:130409982-130410004 CTGTGGCAGGAAAGTGAAGGAGG - Intergenic
1076583796 10:131532129-131532151 GTGTGGCAGTTGAGCAATGGTGG - Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076859460 10:133133753-133133775 CTGTGGTTGTTCAGGGCAGGCGG + Intergenic
1078328061 11:10396568-10396590 ATGTGGCAGATGAAGGAAAGAGG + Intronic
1079085668 11:17443117-17443139 CTGCTGCTGTCGAGGGAAGGAGG + Intronic
1079173052 11:18114490-18114512 CTGTGGCTGCTGGGGGCAGGGGG + Intronic
1079636124 11:22743611-22743633 TTGTAGCAGTGGAGGGAGGGAGG - Intronic
1080256451 11:30295735-30295757 GTGATGCAGTTCAGGGAAGGGGG - Intergenic
1080329225 11:31115972-31115994 CTGTGGCAGTGGGGGGGGGGGGG + Intronic
1080542352 11:33280013-33280035 CTGGGGGAGCTGAGGGGAGGTGG + Intronic
1080578615 11:33623123-33623145 CTGGGGCAGGTGTGGGAAGTGGG - Intronic
1081302583 11:41470679-41470701 TTGTGTCAGATGAGGGAAGTGGG + Intergenic
1082062142 11:47870157-47870179 TTGTGGCAGTTGAGTGAAACTGG - Intergenic
1083163315 11:60868771-60868793 CTGAGGCAGCTGAGGAAGGGAGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083491938 11:63019946-63019968 GTGAGGCAGTTCAGGGAATGAGG + Intergenic
1083620522 11:64047185-64047207 CTGGGGCAGGGGAGGGGAGGGGG - Intronic
1083626707 11:64075563-64075585 ATCTGGCTGCTGAGGGAAGGAGG - Intronic
1083895981 11:65619969-65619991 CTCAGGCTGTTGGGGGAAGGCGG - Intronic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084972185 11:72777930-72777952 CTGAGGCAGGAGAGGGGAGGGGG + Intronic
1085346567 11:75771884-75771906 CTGTTGAATTTGAGGGCAGGAGG - Intronic
1085926709 11:81032593-81032615 CTTTGGTGGTTGGGGGAAGGAGG + Intergenic
1086883861 11:92180786-92180808 CTGTGGCGGTGGGGTGAAGGTGG + Intergenic
1088613929 11:111603604-111603626 TTGAGGCAGTGGAAGGAAGGGGG - Intronic
1089309993 11:117551681-117551703 ATGGGGCAGTTGGGGAAAGGGGG + Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089504884 11:118956438-118956460 CTCTGGCAGGGGTGGGAAGGGGG + Intronic
1090205645 11:124882617-124882639 TTGTGGCAGTTGCGGGGAGGAGG - Intergenic
1090374865 11:126281578-126281600 CTATGGCCTTTGAGGGATGGAGG + Intergenic
1090487472 11:127126942-127126964 CTCTGGCAGGTGATGGAAGGAGG + Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091105598 11:132916622-132916644 CTTTGGCGGCTGAAGGAAGGTGG + Intronic
1092126619 12:6079247-6079269 CTGTGGCAGAACAGGGAAGCTGG - Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1093782645 12:23154872-23154894 CTGTGGCTGCTGAGGCCAGGTGG + Intergenic
1093863274 12:24194260-24194282 CTGTGGGGGGTGATGGAAGGTGG + Intergenic
1094081844 12:26545361-26545383 ATGTGACAATTGTGGGAAGGGGG + Intronic
1095556625 12:43513905-43513927 CTGTTGCGGGTGAGGGGAGGGGG + Intronic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1096454711 12:51775433-51775455 CAGTGACAGTTCTGGGAAGGGGG - Intronic
1098288472 12:68933087-68933109 CTGTGGCAGCTGCCGGACGGCGG - Intronic
1099284832 12:80704694-80704716 TTTTGGGAGTTGAGGGCAGGAGG - Intergenic
1100346531 12:93737074-93737096 CTGGGATAGTTGAGGGAAGGTGG + Intronic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101454469 12:104815902-104815924 GGGTGGCAGGTGGGGGAAGGTGG + Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1103350596 12:120280845-120280867 CTTTGGGAGGTCAGGGAAGGTGG + Intergenic
1103682032 12:122701840-122701862 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103683780 12:122715301-122715323 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103705163 12:122867391-122867413 CTGGGGCAGGGTAGGGAAGGGGG + Exonic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1105758673 13:23493326-23493348 GCCAGGCAGTTGAGGGAAGGTGG - Intergenic
1105774040 13:23639752-23639774 CTGAGGCAGTGGTGGGAGGGAGG + Intronic
1106313658 13:28575504-28575526 CTGTGGCCGTTGAGGAAGAGAGG - Intergenic
1106505065 13:30364061-30364083 CGGTGGCAGTTTAAGGTAGGTGG - Intergenic
1107985447 13:45772080-45772102 CTGGGGCAATTTAGGGTAGGGGG - Intergenic
1108004836 13:45935838-45935860 CTGTGGCAGTTGTGGGTTGGTGG - Intergenic
1110032144 13:70629209-70629231 ATGTGGCAGTGGAGGGGAAGGGG + Intergenic
1110582092 13:77142493-77142515 CTTTGGCAGTGGAGGTAAAGAGG - Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1114949005 14:27723581-27723603 CTGAGTCAGATGAGGAAAGGTGG + Intergenic
1115779750 14:36756206-36756228 CGGGGGCAGCTGAGGGAAGGTGG + Intronic
1117451402 14:55853580-55853602 ATGTGGGAGTTGAAGGAATGGGG - Intergenic
1117839550 14:59845453-59845475 CTGTGGCAGTGGAGAGCAAGAGG - Intronic
1118837566 14:69487460-69487482 CTGGAGCAGTTAAGGGGAGGGGG + Intronic
1119163991 14:72477123-72477145 CTGTGGGAGCTGGAGGAAGGAGG + Intronic
1119288627 14:73476425-73476447 CTGTAGGAGTTCAGGGAAGGGGG - Intergenic
1120212459 14:81646989-81647011 CTGTGGCACTTCAGGAAAGTGGG - Intergenic
1120731095 14:88002373-88002395 GTGTGGCAGTAGTGGGAAGTGGG - Intergenic
1121641067 14:95485248-95485270 CTGATGCAGTTGAGGCAAGAAGG - Intergenic
1122289419 14:100672186-100672208 CTGTGGCACAAGAGGGCAGGAGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122651513 14:103229434-103229456 CTTGGGCAGATGAGAGAAGGGGG - Intergenic
1122714520 14:103687016-103687038 GTGTGGCTCTTGTGGGAAGGAGG + Intergenic
1122939584 14:104975275-104975297 CTGGTGCAGCTCAGGGAAGGGGG - Intronic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1202878563 14_KI270722v1_random:34395-34417 CTGGGGCAGTTGTGGGGAAGTGG + Intergenic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1124872128 15:33553631-33553653 CTGCTGAAGTTGGGGGAAGGAGG - Intronic
1125186163 15:36933036-36933058 CTGTGGGTGCTGAGAGAAGGGGG - Intronic
1125820700 15:42627580-42627602 CAGTGGCGGTAGAGGGAAAGGGG - Intronic
1125957527 15:43800561-43800583 CTGTGTCAGTTGCCGGAAGTCGG + Exonic
1125999435 15:44195216-44195238 CGGTGGCGGCTGAGGGAAGGAGG - Exonic
1126113621 15:45189337-45189359 CTGAGGCAGTGGGGGAAAGGGGG - Intronic
1126385940 15:48093479-48093501 CTGAGGAAGATGAGGGAAGGGGG - Intergenic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1127133566 15:55895504-55895526 CTGTGGTAGCTGAGGAAAGCTGG + Intronic
1128246150 15:66134218-66134240 CTGTGCCTGTTGTGGGAGGGAGG - Intronic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128990954 15:72260076-72260098 CTTTGGGAGGTGAAGGAAGGCGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130684504 15:86024946-86024968 TTCTGGCAATTGAGTGAAGGTGG + Intergenic
1130806122 15:87324987-87325009 GTGAGGCAGGTGAGGGGAGGGGG + Intergenic
1132906228 16:2284129-2284151 CTGTGGGAGGTGGGGCAAGGCGG + Intronic
1133325176 16:4937571-4937593 TGGTGGCAATTGAGGGAAGGGGG + Intronic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134013789 16:10874442-10874464 CTGTGGCAGGTGAGGGTGTGGGG - Intergenic
1134263933 16:12676488-12676510 CTTTTGCAGATGAGGGAATGAGG + Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135917694 16:26620969-26620991 GAGTGGCAGTTCAGGGAGGGTGG - Intergenic
1136034865 16:27531465-27531487 CTGAGCCAGTAGAGGGAAAGGGG - Intronic
1136591605 16:31221160-31221182 GTGTGGCCGTTGAGGGAAAGAGG + Intronic
1138353159 16:56357498-56357520 TTCTGGCAGGAGAGGGAAGGAGG + Intergenic
1138474053 16:57260295-57260317 CCGTGGCTGTTAATGGAAGGAGG - Intronic
1138485037 16:57335456-57335478 CTGTGGGGGATGAGGGAATGGGG - Intergenic
1138550230 16:57743860-57743882 CTGTGGCGGTTGGAGGAGGGTGG - Intronic
1138857563 16:60712921-60712943 CTTTGGGAGGTGAGGGAGGGAGG + Intergenic
1139011919 16:62645054-62645076 CTGGGGCAGTTGAGGGTATCTGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1141634422 16:85306361-85306383 GAGCGGCAGTTGAGGGAAGTGGG + Intergenic
1141897387 16:86967060-86967082 CTGTGGCAGTGTGGAGAAGGGGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1143276059 17:5711723-5711745 CTGTCGAAGTTGATGGATGGAGG + Intergenic
1143335522 17:6169157-6169179 CTGGGACAGTTTAGGGCAGGTGG - Intergenic
1143500356 17:7335248-7335270 GTGTGGCAGAGGAGTGAAGGAGG - Intergenic
1144190183 17:12838556-12838578 CGGTGGCAGTGGAGGGAATCAGG + Intronic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144575755 17:16428405-16428427 CAGAGACAGTTGAGAGAAGGAGG - Intronic
1144702364 17:17347956-17347978 CTGGGGCAGGTGCGGGAAGGAGG - Intergenic
1145851664 17:28104934-28104956 GTGTGGGAGTTTGGGGAAGGTGG - Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146275727 17:31514430-31514452 ATGTGGCTGTAGGGGGAAGGTGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146748568 17:35354483-35354505 CTGTGGCAGTGGAGGAGGGGGGG - Intronic
1148283386 17:46366963-46366985 TAGTGGCACTTGGGGGAAGGTGG - Intergenic
1148305604 17:46584884-46584906 TAGTGGCACTTGGGGGAAGGTGG - Intergenic
1148327194 17:46790134-46790156 CTGATGAAGTTGGGGGAAGGAGG - Intronic
1148794298 17:50189787-50189809 CGGTGGCAGGTGAGGGCAGCTGG - Intronic
1150569112 17:66370153-66370175 CTGTGGAGGTTGAGGGGATGTGG - Intronic
1150904894 17:69326972-69326994 CTGGGGGAGTTGAGGGGACGAGG - Intronic
1151229570 17:72674147-72674169 ATGTGGCAAGGGAGGGAAGGAGG - Intronic
1151476853 17:74349042-74349064 TTGTGGAAGTGGAGGAAAGGAGG + Intronic
1153239491 18:3017462-3017484 GTAGGGCAATTGAGGGAAGGTGG - Intergenic
1154063414 18:11084522-11084544 CCGTGGGAGGTGAGGAAAGGGGG - Intronic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1155416591 18:25605627-25605649 CATAGGCTGTTGAGGGAAGGTGG - Intergenic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1158283673 18:55854970-55854992 CTGTGGAAGTTTGGAGAAGGTGG + Intergenic
1158888302 18:61849473-61849495 GTGTGGCTGTTGGGGGAAAGAGG - Intronic
1160491330 18:79338454-79338476 CTTGGGGAGTTCAGGGAAGGTGG - Intronic
1160922826 19:1528768-1528790 AGGTGGCAGTTGTGGGCAGGTGG - Intronic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1162113559 19:8414510-8414532 CTTTGGGAGTTCAAGGAAGGTGG - Intronic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1163077521 19:14907880-14907902 CTGGGGCAGTTGAGGGAGAAGGG + Intergenic
1163097131 19:15067298-15067320 CTTTGGGAGGTGAGGGCAGGAGG + Intergenic
1163529966 19:17843261-17843283 CTGTGGCAGTCCAGGGGTGGGGG - Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1163817445 19:19475483-19475505 CTGGGGCAGTGGAGGGGGGGGGG - Intronic
1164482160 19:28620229-28620251 CTCTGGGAGTTGAGGGTGGGAGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165711161 19:38011951-38011973 CTGTGGAGGATGAGGGAAGGAGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166354282 19:42217733-42217755 CTGCGCGAGTTGGGGGAAGGAGG - Intronic
1166427870 19:42696052-42696074 CTGTGGGAGTTCAGTCAAGGTGG + Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167772209 19:51528419-51528441 GTCTTGCAGTTGGGGGAAGGGGG - Intronic
1167918048 19:52758266-52758288 CTTTGGCAGTTGGGGGTAGGGGG + Intergenic
1167924030 19:52809130-52809152 CTTGGGCAGTTGCGGGCAGGGGG + Intronic
1167929198 19:52850220-52850242 CTTTGGCAGTTGTGGGCAGGGGG + Intronic
925202414 2:1979288-1979310 CCGTGGCAGCAGAGAGAAGGAGG + Intronic
926206196 2:10835671-10835693 ATTTGGCAGCTGAGTGAAGGTGG - Intronic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927885875 2:26718181-26718203 CTGTGGGAGATGGGGGCAGGTGG - Intronic
928217121 2:29371070-29371092 ATGTTGGAGCTGAGGGAAGGAGG + Intronic
928461169 2:31474200-31474222 CTGTGGTAGTTGAGGCAGGGTGG - Intergenic
929487791 2:42370240-42370262 GTGAGGCAGTTGGTGGAAGGAGG + Intronic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
933271250 2:80235482-80235504 CTGAGGAAGTTGTGGGAAGCAGG + Intronic
933315942 2:80715205-80715227 CAGTGGCATTTGAGGAAAGCAGG + Intergenic
933722198 2:85405140-85405162 TTCTGGCATTTGAGGGAAGCTGG - Intronic
934651329 2:96092735-96092757 CTGTGGCGGCCGGGGGAAGGTGG + Intergenic
934709543 2:96505934-96505956 TTGTGGCAGTTCTGGGAAAGTGG - Intronic
934891912 2:98078096-98078118 CTAGGGCAGTTGAGGCAGGGGGG - Intergenic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
935884794 2:107604856-107604878 CTGTGGCATTTGAAGCAAGACGG - Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937908829 2:127065551-127065573 TGTTGGCAGTTGAGGGCAGGGGG - Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938537648 2:132258277-132258299 CTTTGGGAGGCGAGGGAAGGTGG + Intergenic
939175853 2:138746556-138746578 TTGTGGCAGTTTTGGGAAGCTGG - Intronic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
941125498 2:161579135-161579157 ATGGGGTAGTTGAGGGGAGGAGG + Intronic
941688046 2:168468025-168468047 TTGTGCCAGTTTAGGGAGGGAGG + Intronic
943728276 2:191274571-191274593 ATTTGGCAGATGAGGGAAGAAGG - Intronic
946834957 2:223763513-223763535 CTCTGGGAGTTGGGGGCAGGTGG - Intronic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947183317 2:227432039-227432061 CTAGTGCAGTTGTGGGAAGGAGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947601233 2:231451731-231451753 CTTTGGCACCTGGGGGAAGGGGG + Intergenic
948169565 2:235890092-235890114 CTGTGTAGGTTGAGAGAAGGAGG + Intronic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
1170471087 20:16669030-16669052 CTGTGGCGAATTAGGGAAGGTGG + Intergenic
1170709654 20:18778872-18778894 CTGTCACAGTGGAGGGAAGTAGG + Intergenic
1170894599 20:20402182-20402204 CTCTGACAGTTGAGGAATGGAGG - Intronic
1171464810 20:25320000-25320022 CTGAAGGGGTTGAGGGAAGGCGG - Intronic
1171811108 20:29744465-29744487 CTTTGGGAGGTGAGGGAAGGTGG + Intergenic
1171866559 20:30490060-30490082 CTTTGGGAGGCGAGGGAAGGTGG + Intergenic
1172325270 20:34029564-34029586 ATTTGGCAGTTGTGGGAATGGGG + Intronic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1172578810 20:36030732-36030754 CTGTGGGACTTGGAGGAAGGGGG + Intergenic
1173435457 20:43028393-43028415 CTGTGACACTTCAGGGAAGTTGG - Intronic
1173531261 20:43771575-43771597 CAGGGGCAGTGGAGGAAAGGGGG - Intergenic
1173688648 20:44941879-44941901 TTGATGCAGTGGAGGGAAGGGGG - Intronic
1174285369 20:49468963-49468985 CTATGGAAGTTTTGGGAAGGGGG + Intronic
1176231757 20:64036495-64036517 TTCTGGCAGTTGGGGGAGGGGGG + Intronic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177904544 21:26959745-26959767 ATGTGACAGGTGAGAGAAGGAGG - Intronic
1178371898 21:32033332-32033354 GTGTGGCCTTTGAGGCAAGGAGG - Intronic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179403065 21:41102321-41102343 CTGTGACAGCTGCTGGAAGGTGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1180341997 22:11627443-11627465 CTTTGGGAGGCGAGGGAAGGTGG - Intergenic
1181517487 22:23423521-23423543 CTTTGGCAGTGGAGGCAGGGAGG + Intergenic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1183191676 22:36325603-36325625 CGGTGGCAGGTGAGGGCAGCCGG + Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184860214 22:47169248-47169270 CTGTTGAAGTTGAGGGCCGGTGG - Intronic
1185054788 22:48573979-48574001 CTGTGCCAGGTGAGGGATGAAGG + Intronic
1185076865 22:48687809-48687831 CTGGGGCAGCCCAGGGAAGGTGG - Intronic
949436668 3:4037300-4037322 CTATAGAAGTTGAAGGAAGGAGG - Intronic
949488839 3:4567845-4567867 CTGTGGAAGTCCAGGGCAGGTGG - Intronic
949490414 3:4583786-4583808 CTGGGGCAGTTGCAGGATGGGGG + Intronic
949950421 3:9224530-9224552 TTGTGGCAATTTTGGGAAGGCGG - Intronic
950199159 3:11030642-11030664 CTGAGGCATTTGAGGGACGAGGG + Intronic
950417815 3:12878348-12878370 CTGTGGCAGTTGCCAGAAGCTGG - Intergenic
950453673 3:13079878-13079900 CTATGTAAGATGAGGGAAGGAGG + Intergenic
950953829 3:17029693-17029715 CTGTAGCAGTTGGGGGAAAGTGG - Intronic
951269583 3:20608156-20608178 TTGGGGCTGTTGAGGGGAGGGGG + Intergenic
952588589 3:34923575-34923597 GAGTGTCAGTTGAAGGAAGGTGG + Intergenic
953451130 3:43007325-43007347 CTGGGACAGTTGAGGGCAGTGGG - Intronic
953553731 3:43925231-43925253 AGGTGGCAGTTGGGGGATGGAGG + Intergenic
954397112 3:50298772-50298794 GTGTGGGAGGTGAGGGGAGGGGG - Intronic
954593252 3:51802203-51802225 CTGTTGCTGTTGAGCCAAGGGGG - Intergenic
955196119 3:56806297-56806319 GTGTCACAGTTGAGGGAAGCTGG + Intronic
956170678 3:66431227-66431249 CTCTGCCCCTTGAGGGAAGGAGG + Intronic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
958963873 3:100536899-100536921 TTTTGGCAGTAGGGGGAAGGAGG + Intronic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
962440665 3:135412742-135412764 CTGTGGCAGCCAAGGGCAGGTGG - Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
962627182 3:137237444-137237466 CAGAGGCAGATGAGGGAAGTGGG + Intergenic
963352860 3:144174061-144174083 CAGTGGGAGTTGAAGAAAGGTGG + Intergenic
963860775 3:150308146-150308168 CTGTGGCAGTTGGTGGAGGCAGG + Intergenic
964069982 3:152619711-152619733 CTGTGCCAGTTGAGGGCATATGG + Intergenic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
967513141 3:190336020-190336042 CTTTGGCATTTGAGAGAAGTAGG + Intronic
967667870 3:192196010-192196032 CTGGGGTGGTTGGGGGAAGGGGG - Intronic
968731487 4:2271307-2271329 CTGCCGCAGCTGTGGGAAGGTGG - Exonic
968762398 4:2449476-2449498 CGTTGGCAGTAAAGGGAAGGAGG - Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
970046145 4:11856873-11856895 CTGCTGCAGTGGAGGGCAGGAGG - Intergenic
970194754 4:13542982-13543004 CTGGTGCAGGTAAGGGAAGGTGG + Intronic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
973060514 4:45718510-45718532 CTGCTGCAGTTGGGGAAAGGTGG - Intergenic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
974604904 4:64139632-64139654 CAGGGGCAGTTGGGGGATGGGGG - Intergenic
976744929 4:88392930-88392952 CTGGGGAGGTTGAGGCAAGGGGG - Intronic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
979654533 4:123176837-123176859 TTGTGGGAGGTGGGGGAAGGGGG + Intronic
980002154 4:127502450-127502472 CTGTGGCAGTTTGGGGAAGCAGG + Intergenic
980320508 4:131266937-131266959 GTTTAGCAGTAGAGGGAAGGTGG - Intergenic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
982541328 4:156675124-156675146 ATGTGGCAGTTGAGGAAAATGGG - Intergenic
983327477 4:166275171-166275193 CTGTTGGAATTGAGGGAATGAGG + Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
987228751 5:15870454-15870476 CTGTGGCAGTAGAGAGGATGAGG + Intronic
987247092 5:16060072-16060094 CTGTGGCATTTAACGCAAGGAGG - Intergenic
987367730 5:17164184-17164206 ATGAGGCAGGTGAGGGAAAGCGG - Intronic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
989349020 5:40463388-40463410 GTGTGGCAGTTTAGGGAGGTGGG + Intergenic
989516675 5:42352063-42352085 CTATGGGAGTTCAGGGAAAGGGG + Intergenic
990369407 5:55102090-55102112 CTGTGGCAGGTGTGGGAACATGG - Intergenic
991645385 5:68795814-68795836 AGGTGGGAGGTGAGGGAAGGTGG - Intergenic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992103826 5:73433755-73433777 CTGTTTCTGTTGAGGGAAGGAGG + Intergenic
992403478 5:76432932-76432954 GTGAGGAAGCTGAGGGAAGGAGG - Intronic
994584219 5:101684998-101685020 CTGTTGTAGTTGGGGGAAGGGGG - Intergenic
995204031 5:109458397-109458419 CTTTGACAGTTGAGAGAAGAAGG + Intergenic
997023759 5:130033346-130033368 CTCTGGCAAGTGAGGGAAAGAGG - Intronic
997239571 5:132296528-132296550 CTGTGGCACCTGTGGGAAGTGGG + Intronic
997263005 5:132478077-132478099 TTGTGGATGCTGAGGGAAGGCGG - Intergenic
997434628 5:133865440-133865462 CTGTGAGAGGTGGGGGAAGGTGG + Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999462688 5:151771026-151771048 TTGTGGCAGCTGAGGCACGGTGG - Intronic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001380644 5:171304371-171304393 CTGTGGCAGGTGAATGAATGAGG - Intergenic
1001886080 5:175291610-175291632 CTGTGGCACTTGGGACAAGGGGG - Intergenic
1002523006 5:179801615-179801637 GTGTGGCAGGTGATGGAAGACGG + Exonic
1003112589 6:3261978-3262000 ATGTGGGAGTTTAGGGAAGCTGG - Intronic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1005460951 6:26070026-26070048 CTTAGGCAGTGGAGAGAAGGAGG + Intergenic
1005475747 6:26205955-26205977 CTGTGGCAGTGAAGGGGAGCTGG - Intergenic
1005493763 6:26370641-26370663 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1005498317 6:26407990-26408012 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006361311 6:33588853-33588875 CTGTGCCAGCCGAGGGGAGGTGG + Intergenic
1006573325 6:35023504-35023526 CTGTGGCAGTAGAGTCATGGCGG + Intronic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006904827 6:37526135-37526157 GTGTGGCAGGTGGGGGGAGGTGG + Intergenic
1006923725 6:37642740-37642762 CTGTGGCAGTGGAAGGACAGGGG - Intronic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1008041098 6:46799025-46799047 CTGTGAGAGTTTAGTGAAGGAGG + Intronic
1008308622 6:49937025-49937047 ATGTGGCACTGGAGGGAATGAGG + Intergenic
1009502076 6:64426361-64426383 CTGTGTCAGTTGTGGGAACATGG + Intronic
1009916205 6:70000016-70000038 CAGGGGCTGTTGAGGGATGGAGG - Intronic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011751605 6:90460254-90460276 CTGCCGCATTTGTGGGAAGGCGG - Intergenic
1012289694 6:97437502-97437524 CTGAGGCATCTGAGGGAAGGGGG - Intergenic
1013803999 6:113976637-113976659 CTGTGGGAGTTGGGGGCAAGAGG + Intronic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017951275 6:159137167-159137189 ATGTTGCAGTTGGGGGGAGGGGG + Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020278050 7:6636788-6636810 CTGTGGCGGTTGAGTGCAGGAGG - Intergenic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022466585 7:30656350-30656372 CCGTGGCAGTGAGGGGAAGGGGG - Intronic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1024714282 7:52057492-52057514 CTTTTGCAGATGGGGGAAGGTGG - Intergenic
1026204002 7:68239643-68239665 AGGTGGCAGTGAAGGGAAGGAGG + Intergenic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1027188749 7:75986198-75986220 CTGTGGAAGTTGATCGAAGGCGG + Exonic
1028136900 7:87231431-87231453 CTTTGGCAGTTGTGGGATGTGGG + Intergenic
1028271143 7:88791204-88791226 CTTTGGCAGTTGAATAAAGGAGG - Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1031016999 7:116586018-116586040 CTGGGGCAGTTTAGGGCAGTGGG - Intergenic
1031456786 7:121990761-121990783 CTTTGGGAGGTGAGGGCAGGCGG - Intronic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032275138 7:130447580-130447602 GTGGGGCAGGTGAGGGGAGGAGG + Intergenic
1032278712 7:130483631-130483653 CTCTGGTGGTTGGGGGAAGGGGG - Intergenic
1032519740 7:132534864-132534886 CTGTGGCAGGTTAAGGAATGGGG - Intronic
1032607037 7:133366932-133366954 CCGTGGCAATGGAGTGAAGGAGG + Intronic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1033573432 7:142656682-142656704 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1035132425 7:156668454-156668476 CAGAGGCTGTTGAGGGGAGGCGG + Intronic
1035424256 7:158757076-158757098 CAGTAGCAGTTGAGGAATGGAGG + Intronic
1036289865 8:7477801-7477823 CTGTCTCACTTGAGGGATGGGGG + Intergenic
1036331614 8:7833726-7833748 CTGTCTCACTTGAGGGATGGGGG - Intergenic
1038163101 8:25059246-25059268 CTGTGGCAGGTGATGGGTGGTGG - Intergenic
1038816842 8:30912845-30912867 ATGTGGCAGATGAGGAGAGGAGG - Intergenic
1041456874 8:58070354-58070376 CTGTGGGAGGTCAGTGAAGGAGG + Intronic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1043418924 8:80079289-80079311 CTGTAGAAGTTGGGGGCAGGAGG - Intronic
1044629784 8:94267088-94267110 CTGGGCCAATGGAGGGAAGGAGG - Intergenic
1045551921 8:103180523-103180545 TTGTGGCAGTTACAGGAAGGAGG + Intronic
1045864164 8:106845806-106845828 CTATGGCAGTGGAGGGTAGGGGG - Intergenic
1048394167 8:133997701-133997723 CTATAGAGGTTGAGGGAAGGGGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048937509 8:139369113-139369135 CTGTAGCATTTCAGGGAAGTTGG - Intergenic
1049850730 8:144828879-144828901 CCATGGCACTTGAGTGAAGGAGG - Intronic
1051082147 9:13306520-13306542 CTTTGACAGTTGAGAGAAGAAGG - Intergenic
1051306771 9:15718213-15718235 CTGTGGCAGTGGTGGCCAGGGGG + Intronic
1051677104 9:19569616-19569638 AGGTTGCATTTGAGGGAAGGAGG - Intronic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1051829375 9:21258164-21258186 CTGTGCCAGTTCTGTGAAGGGGG - Intergenic
1052886038 9:33649076-33649098 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1055604292 9:77951745-77951767 CTGTTCCATTTGTGGGAAGGTGG + Intronic
1057304244 9:93903191-93903213 ATGTGGCAGGTGGGGGTAGGTGG + Intergenic
1057543228 9:95995903-95995925 CTGTTGCATTTCAGGGAATGGGG - Intronic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1058710136 9:107672093-107672115 CTGTCCCACTTGAGGGAAAGTGG + Intergenic
1060515034 9:124260116-124260138 CTGGGGCAGCTGAGAGGAGGTGG + Intronic
1060937938 9:127526812-127526834 CTGTGGCTGTCGAGGGTGGGAGG + Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061073873 9:128328843-128328865 CTGTCGCTGTGGAGGGGAGGGGG + Intronic
1061675388 9:132212702-132212724 CTTGGGCACTAGAGGGAAGGAGG - Intronic
1061826665 9:133262204-133262226 GTGGGGCAGGTGAGAGAAGGAGG - Intronic
1062052460 9:134454678-134454700 CTGAGGCAGGAGAGGGGAGGAGG - Intergenic
1062579165 9:137221975-137221997 CTGGGGCAGGTGAGCGCAGGGGG - Intergenic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1203361741 Un_KI270442v1:222382-222404 CTTTGGGAGGTGAGGGAAGGTGG + Intergenic
1185763916 X:2708979-2709001 CTGTGGCCTCTGAGGGCAGGTGG + Intronic
1185875642 X:3699707-3699729 CTTTGGAAGTTGTGGGATGGTGG - Intronic
1186207162 X:7213047-7213069 CTTTGGGAGGTCAGGGAAGGAGG - Intergenic
1186207271 X:7213836-7213858 CTTTGGGAGGTCAGGGAAGGAGG + Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1187052458 X:15708206-15708228 TGGTGGCAGGCGAGGGAAGGGGG - Intronic
1187428122 X:19197005-19197027 CTGTGGCAGAGTAGGGATGGGGG - Intergenic
1188843745 X:35047712-35047734 CAGTGGCAGCTGAGAGAATGAGG - Intergenic
1189608914 X:42710625-42710647 GTGTGGCAGTGGAGGTATGGGGG + Intergenic
1189667744 X:43375571-43375593 CCGTGGAAGGTGGGGGAAGGAGG - Intergenic
1190741460 X:53291702-53291724 ATGTGGCAGCTGTGGGGAGGGGG - Intronic
1190984771 X:55490180-55490202 CTCTGGGAGTTGACGGAGGGAGG + Intergenic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1191858206 X:65644593-65644615 CAGTGGCAGCTCAGGGCAGGGGG + Intronic
1192183973 X:68933955-68933977 CTTTGGGAGGTGAAGGAAGGAGG + Intergenic
1192223143 X:69211022-69211044 CTGTGGCAGCTGGGGGGAGATGG - Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic
1201572736 Y:15431905-15431927 TTGTGGGAGTTGGGGGAGGGGGG + Intergenic