ID: 1167042835

View in Genome Browser
Species Human (GRCh38)
Location 19:47032687-47032709
Sequence AGACTGTCTCTGAGATGTAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167042835_1167042841 7 Left 1167042835 19:47032687-47032709 CCTCTACATCTCAGAGACAGTCT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1167042841 19:47032717-47032739 TCTGGGTCTCTCACAGGTAAGGG 0: 1
1: 0
2: 1
3: 10
4: 130
1167042835_1167042840 6 Left 1167042835 19:47032687-47032709 CCTCTACATCTCAGAGACAGTCT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1167042840 19:47032716-47032738 ATCTGGGTCTCTCACAGGTAAGG 0: 1
1: 0
2: 0
3: 12
4: 125
1167042835_1167042844 29 Left 1167042835 19:47032687-47032709 CCTCTACATCTCAGAGACAGTCT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1167042844 19:47032739-47032761 GACCCCCAGTGGACCTGGATTGG 0: 1
1: 0
2: 1
3: 6
4: 96
1167042835_1167042839 1 Left 1167042835 19:47032687-47032709 CCTCTACATCTCAGAGACAGTCT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1167042839 19:47032711-47032733 CATCTATCTGGGTCTCTCACAGG 0: 1
1: 0
2: 1
3: 11
4: 150
1167042835_1167042837 -10 Left 1167042835 19:47032687-47032709 CCTCTACATCTCAGAGACAGTCT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1167042837 19:47032700-47032722 GAGACAGTCTCCATCTATCTGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1167042835_1167042843 24 Left 1167042835 19:47032687-47032709 CCTCTACATCTCAGAGACAGTCT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1167042843 19:47032734-47032756 TAAGGGACCCCCAGTGGACCTGG 0: 1
1: 0
2: 0
3: 7
4: 90
1167042835_1167042842 18 Left 1167042835 19:47032687-47032709 CCTCTACATCTCAGAGACAGTCT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1167042842 19:47032728-47032750 CACAGGTAAGGGACCCCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167042835 Original CRISPR AGACTGTCTCTGAGATGTAG AGG (reversed) Exonic