ID: 1167042838

View in Genome Browser
Species Human (GRCh38)
Location 19:47032710-47032732
Sequence CTGTGAGAGACCCAGATAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 1, 2: 4, 3: 18, 4: 513}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167042838_1167042843 1 Left 1167042838 19:47032710-47032732 CCATCTATCTGGGTCTCTCACAG 0: 1
1: 1
2: 4
3: 18
4: 513
Right 1167042843 19:47032734-47032756 TAAGGGACCCCCAGTGGACCTGG 0: 1
1: 0
2: 0
3: 7
4: 90
1167042838_1167042842 -5 Left 1167042838 19:47032710-47032732 CCATCTATCTGGGTCTCTCACAG 0: 1
1: 1
2: 4
3: 18
4: 513
Right 1167042842 19:47032728-47032750 CACAGGTAAGGGACCCCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 156
1167042838_1167042844 6 Left 1167042838 19:47032710-47032732 CCATCTATCTGGGTCTCTCACAG 0: 1
1: 1
2: 4
3: 18
4: 513
Right 1167042844 19:47032739-47032761 GACCCCCAGTGGACCTGGATTGG 0: 1
1: 0
2: 1
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167042838 Original CRISPR CTGTGAGAGACCCAGATAGA TGG (reversed) Exonic