ID: 1167042838 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:47032710-47032732 |
Sequence | CTGTGAGAGACCCAGATAGA TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 537 | |||
Summary | {0: 1, 1: 1, 2: 4, 3: 18, 4: 513} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167042838_1167042843 | 1 | Left | 1167042838 | 19:47032710-47032732 | CCATCTATCTGGGTCTCTCACAG | 0: 1 1: 1 2: 4 3: 18 4: 513 |
||
Right | 1167042843 | 19:47032734-47032756 | TAAGGGACCCCCAGTGGACCTGG | 0: 1 1: 0 2: 0 3: 7 4: 90 |
||||
1167042838_1167042842 | -5 | Left | 1167042838 | 19:47032710-47032732 | CCATCTATCTGGGTCTCTCACAG | 0: 1 1: 1 2: 4 3: 18 4: 513 |
||
Right | 1167042842 | 19:47032728-47032750 | CACAGGTAAGGGACCCCCAGTGG | 0: 1 1: 0 2: 1 3: 11 4: 156 |
||||
1167042838_1167042844 | 6 | Left | 1167042838 | 19:47032710-47032732 | CCATCTATCTGGGTCTCTCACAG | 0: 1 1: 1 2: 4 3: 18 4: 513 |
||
Right | 1167042844 | 19:47032739-47032761 | GACCCCCAGTGGACCTGGATTGG | 0: 1 1: 0 2: 1 3: 6 4: 96 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167042838 | Original CRISPR | CTGTGAGAGACCCAGATAGA TGG (reversed) | Exonic | ||