ID: 1167042842

View in Genome Browser
Species Human (GRCh38)
Location 19:47032728-47032750
Sequence CACAGGTAAGGGACCCCCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167042835_1167042842 18 Left 1167042835 19:47032687-47032709 CCTCTACATCTCAGAGACAGTCT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1167042842 19:47032728-47032750 CACAGGTAAGGGACCCCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 156
1167042838_1167042842 -5 Left 1167042838 19:47032710-47032732 CCATCTATCTGGGTCTCTCACAG 0: 1
1: 1
2: 4
3: 18
4: 513
Right 1167042842 19:47032728-47032750 CACAGGTAAGGGACCCCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167042842 Original CRISPR CACAGGTAAGGGACCCCCAG TGG Exonic