ID: 1167043371

View in Genome Browser
Species Human (GRCh38)
Location 19:47036022-47036044
Sequence TGCTGGAGCAACTGGGGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 1, 2: 5, 3: 85, 4: 551}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167043365_1167043371 -4 Left 1167043365 19:47036003-47036025 CCTGGGGACCACTCAGAGGTGCT 0: 1
1: 0
2: 2
3: 9
4: 151
Right 1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG 0: 1
1: 1
2: 5
3: 85
4: 551
1167043364_1167043371 -3 Left 1167043364 19:47036002-47036024 CCCTGGGGACCACTCAGAGGTGC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG 0: 1
1: 1
2: 5
3: 85
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167043371 Original CRISPR TGCTGGAGCAACTGGGGCTG CGG Exonic
900213288 1:1467849-1467871 GGCTGGAGCTGCTGGGGCTGTGG - Intronic
900218511 1:1494961-1494983 GGCTGGAGCTACTGGGGCTGTGG - Intronic
900220849 1:1508668-1508690 GGCTGGAGCTGCTGGGGCTGTGG - Intergenic
900225858 1:1533388-1533410 GGCTGGAGCTGCTGGGGCTGTGG - Intronic
900245750 1:1635291-1635313 TGCTGGCACAGCTGGGGCTGGGG + Intronic
900256980 1:1702448-1702470 TGCTGGCACAGCTGGGGCTGGGG + Intronic
900634300 1:3654471-3654493 TGCTGGAGTAAATGGGGAAGAGG - Intronic
900868005 1:5282584-5282606 TGCTCAAGCCACTGGGTCTGTGG + Intergenic
901124704 1:6920813-6920835 GGCTGGAGCAACTGGGACATAGG + Intronic
901326840 1:8371741-8371763 GGCTGGAGCAACAGGGGCCGGGG + Intronic
901816263 1:11795112-11795134 TGCTGAAGCGCCTGGGGATGTGG - Exonic
902504428 1:16930112-16930134 TACTGGAGAATCTGGGGATGGGG - Exonic
902504443 1:16930185-16930207 AGCTGGAGCAGCAGCGGCTGAGG + Exonic
903144664 1:21363303-21363325 TGGTGGAGGGGCTGGGGCTGGGG - Intergenic
903176700 1:21585834-21585856 GGCAGGAGAAACTGGAGCTGTGG + Intergenic
903305298 1:22408798-22408820 TGTTGGAGGAATCGGGGCTGGGG + Intergenic
903583166 1:24387505-24387527 TGCTGGGGAAACAGGGTCTGAGG + Intronic
904330659 1:29755959-29755981 TTCTGAAGCAGCTTGGGCTGAGG - Intergenic
904416015 1:30361635-30361657 TTCTGAAGCAGCTTGGGCTGAGG + Intergenic
904619855 1:31768647-31768669 GGATGAAGCAACTGGGGGTGGGG - Intergenic
904774074 1:32896004-32896026 GGCTGGAGGAACAGGGGCAGGGG + Intronic
906209769 1:44006058-44006080 CACTGGAGCATCTGGGGGTGGGG + Intronic
906707760 1:47907148-47907170 AGCTCCAGCAGCTGGGGCTGCGG + Intronic
907297497 1:53464721-53464743 GGCGGGAGGAACTGGGGCTGCGG - Exonic
907417761 1:54326320-54326342 TGCTGGAGAAGCTGGAGGTGAGG - Intronic
909798404 1:79773785-79773807 TCCTATAGCCACTGGGGCTGTGG - Intergenic
910188800 1:84574314-84574336 TGCTGGCGCTGCTGGCGCTGCGG - Exonic
910200192 1:84690727-84690749 TGCGGGCGCAGCTGCGGCTGCGG + Intronic
911104430 1:94118722-94118744 AGATGGAGCCACTCGGGCTGAGG - Intronic
912907109 1:113718746-113718768 GGCTGGAGCAACTGGGACATGGG + Intronic
913218995 1:116644447-116644469 TGCAGAAGCCACTGGGGCAGTGG - Intronic
914230495 1:145761436-145761458 GGCTGGAGCAACTGGGACACAGG - Intronic
914490624 1:148148433-148148455 TGCTGGATCAGCTGGGTCAGGGG + Intronic
915056709 1:153139648-153139670 TGCTGGAGCAACTATGGTGGTGG + Intergenic
915238196 1:154501522-154501544 AGCTGGAGCTACTGCTGCTGGGG + Exonic
915348948 1:155212823-155212845 AGATGGAGCAGCTGGAGCTGGGG + Intronic
915352135 1:155233449-155233471 AGATGGAGCAGCTGGAGCTGGGG + Intergenic
915462909 1:156080653-156080675 TGCTGGAGCAGCAGAGGGTGTGG + Intronic
916533954 1:165685699-165685721 GGCTGGAGAAACAGGGCCTGAGG + Intronic
917061803 1:171049320-171049342 TACTGCTGCCACTGGGGCTGGGG - Intronic
917415073 1:174800448-174800470 TGCTGGAACTTCTGGGGATGGGG + Intronic
918142436 1:181730891-181730913 TGTTTGAGCATCTGGAGCTGTGG + Intronic
920688692 1:208129393-208129415 TGTTGTAGCAGCTGGGGCTGGGG + Intronic
921362224 1:214340821-214340843 TCCTGGTGAAACTGGGGCAGAGG - Intergenic
921621453 1:217330290-217330312 AGCTGGAGCAACTGGGACACAGG + Intergenic
922073094 1:222215788-222215810 GGCTGGAGCATCTGAGTCTGAGG - Intergenic
922175725 1:223195583-223195605 TGATGGAGCAACTGTGGGAGTGG + Intergenic
922447434 1:225709240-225709262 TGCCGGAGCTACTGGAGATGTGG - Intergenic
922753612 1:228082405-228082427 TCCTGCAGCAACTGGAGCTGCGG - Intergenic
924037590 1:239953124-239953146 TGCTGGAGCAACTGGCGACAGGG - Intergenic
924044241 1:240011418-240011440 TGCTGGAGCAACTGGAGCCAGGG - Intergenic
924351148 1:243115719-243115741 TGCCTGGGCAGCTGGGGCTGCGG - Intergenic
924556281 1:245121738-245121760 TGCTGGAGGCACTGGGACTGCGG - Intronic
1062838390 10:651012-651034 TTCTGCAGAAACGGGGGCTGGGG - Exonic
1063461504 10:6217489-6217511 TGATGGAGCTGCTGGGGCAGAGG + Intronic
1064767947 10:18694066-18694088 TGCTGAGGAATCTGGGGCTGAGG + Intergenic
1065125745 10:22572519-22572541 TGCTTGAGCCAGTGGGGCAGAGG + Intronic
1066040792 10:31546419-31546441 GGCTGGAGCAGCTGGGACTCAGG + Intergenic
1067285607 10:44905562-44905584 TGAAGGTTCAACTGGGGCTGGGG + Intergenic
1067414053 10:46090657-46090679 GGAGGGAGCAACTGGGCCTGTGG + Intergenic
1067434102 10:46265167-46265189 GGAGGGAGCAACTGGGCCTGTGG + Intergenic
1067439594 10:46301158-46301180 GGAGGGAGCAACTGGGCCTGTGG - Intronic
1068280081 10:54856286-54856308 GGCAGGAGGAACTGGGGCAGAGG + Intronic
1068399364 10:56508768-56508790 TGCTGGAGCAGCTGGGACGCAGG - Intergenic
1068519495 10:58062972-58062994 TGCTGGAGCAGCTGGGACACAGG + Intergenic
1068905634 10:62318368-62318390 TACTGGAATAACTGGGTCTGGGG - Intergenic
1069071588 10:63995289-63995311 TGCTGCAGCAAATGGTACTGTGG - Intergenic
1069411102 10:68154335-68154357 TGCTGAAGCAGCTGGGGCCAGGG - Intronic
1069477462 10:68747464-68747486 TGCAGCAGTGACTGGGGCTGGGG - Exonic
1069754608 10:70765998-70766020 AGCTGGAGCGACTGGGACTCAGG - Intergenic
1069757591 10:70782612-70782634 CGCAGCAGCTACTGGGGCTGTGG + Intronic
1070736296 10:78865985-78866007 TGCTGGAACAAGTGGGGCCTGGG - Intergenic
1071327766 10:84534060-84534082 AGCTGGAGCAACTGGGACACAGG - Intergenic
1072107471 10:92288374-92288396 TGCTTGAGCCCCTGAGGCTGAGG + Intronic
1072578568 10:96720902-96720924 TGCTGGGGCAGCAGGGGCTTAGG - Intergenic
1072742410 10:97917450-97917472 TGCTGGAGGGGCTGGGGCTGGGG - Intronic
1074496255 10:113982708-113982730 GGCTGGAGCACCTGGTCCTGTGG - Intergenic
1074665946 10:115724366-115724388 TGCTGAAGAAAATGGGCCTGTGG + Intronic
1075027769 10:118999160-118999182 AGCTGGAACAACTCAGGCTGGGG + Intergenic
1075106719 10:119543971-119543993 TTGGGGTGCAACTGGGGCTGTGG - Intergenic
1075427238 10:122351314-122351336 TGCTGGACAGACTGGGGATGGGG + Intergenic
1075448129 10:122528002-122528024 TGCTGGGGGAACTGGGTCAGAGG - Intergenic
1075932887 10:126314184-126314206 TGCTGGAGGAGCTGAGGGTGGGG + Intronic
1076715613 10:132362399-132362421 GGATGGAGCAAATGGGGCTGAGG + Intronic
1076888087 10:133271689-133271711 TCCTGGGGAAACTGGAGCTGGGG + Exonic
1076889333 10:133276274-133276296 TCCTGGAGTGACTTGGGCTGGGG - Intronic
1077350697 11:2091842-2091864 TGCTGGAGCTCCTGGGCCTGCGG + Intergenic
1077674136 11:4182326-4182348 TGCTGGAGGGACTGTGCCTGAGG + Intergenic
1078058711 11:8030056-8030078 AGCTGGTGTAACTGGGGCTCAGG + Intronic
1078452135 11:11448554-11448576 TAATGGAGAAACTGAGGCTGAGG + Intronic
1079007278 11:16800837-16800859 GGGTGGAGCATCTGGGGCTGAGG + Intronic
1079080613 11:17411129-17411151 TGCAGGAGGAACTGGTGCTTAGG - Intronic
1079638999 11:22780700-22780722 AGCTGGAGTAACTGAGTCTGTGG - Intronic
1080298809 11:30760702-30760724 TGCTGGACCAACTGTGTTTGAGG - Intergenic
1080645090 11:34182383-34182405 TGCTGGAGGAGATGAGGCTGGGG - Intronic
1080690222 11:34550003-34550025 TGCAGGAGCAGCTGGGGATTGGG + Intergenic
1080707100 11:34706815-34706837 TGCTAAGCCAACTGGGGCTGGGG + Intergenic
1081423594 11:42901126-42901148 AACTGGAGCAAATGGGCCTGGGG - Intergenic
1081807649 11:45899262-45899284 TGCTGGTGCAGCTGGGGGAGAGG - Intronic
1082834079 11:57639461-57639483 AGCTGGAGCAGCAGGGGCAGGGG - Intergenic
1083581859 11:63830169-63830191 AGTTGGAGAAAGTGGGGCTGAGG + Intergenic
1083840146 11:65299576-65299598 TTCTGCAGCCACTGGGGCTTGGG + Intronic
1084041262 11:66543995-66544017 TGCTGGGGGAACTGACGCTGTGG - Intronic
1084064079 11:66693486-66693508 TCCGGGAGCACGTGGGGCTGGGG - Intronic
1084458362 11:69282238-69282260 TGATGGCTCAACTGGGGCTAAGG - Intergenic
1084654302 11:70506239-70506261 TGCAGGAGCAGCTCTGGCTGGGG - Intronic
1085392776 11:76190954-76190976 TGCTGCAGCAGCTGTGACTGGGG + Intronic
1085603938 11:77880630-77880652 TGCTATGCCAACTGGGGCTGTGG - Intronic
1087019270 11:93585976-93585998 TGCTGGGGCAGCTGGGGCAGTGG - Intergenic
1087182441 11:95153103-95153125 TGCTGGGGGAACCGGGGCTCAGG - Intergenic
1087904686 11:103682018-103682040 TGCTGGAGCATCTGGTGGGGTGG - Intergenic
1089148936 11:116349929-116349951 TGCTGCAGCTCATGGGGCTGGGG + Intergenic
1089539585 11:119181892-119181914 GGCTGGAGCAATAGGGGGTGTGG - Intronic
1090692561 11:129199446-129199468 AGCTGGAGCAGCTGGGGCACAGG - Intronic
1090989200 11:131801019-131801041 TGTTGGGGCATTTGGGGCTGGGG + Intronic
1091339906 11:134802247-134802269 GGCTGGAGCCTGTGGGGCTGAGG - Intergenic
1091929379 12:4382638-4382660 TCCTGGAGCGACTGGGGAAGGGG + Intergenic
1091967327 12:4755449-4755471 TGCTGCAGCTACTGGGGATGGGG + Intronic
1092075043 12:5665807-5665829 GGCTGGATCAGCTGAGGCTGTGG - Intronic
1092099768 12:5873493-5873515 CGCTGGAGGAATTTGGGCTGGGG + Intronic
1092218212 12:6696859-6696881 TGATGGAGGAACAGGGCCTGTGG - Intronic
1092529281 12:9331367-9331389 TGCTGGAGCAGGTGGAGCTCCGG + Intergenic
1093536681 12:20231048-20231070 GGCTGGAGCAACTGGGACACAGG + Intergenic
1094142870 12:27198941-27198963 TACTGGAGCAACAGAGGCTCTGG - Intergenic
1094499343 12:31008531-31008553 GGCTGGAGCAGCTGGGGCAGTGG - Intergenic
1094526717 12:31235936-31235958 TCCTGGAGTAAGTGGGGCTGTGG - Intergenic
1096748391 12:53743436-53743458 TGCTGGAGCCCCTGGGGCGCTGG + Intergenic
1098893189 12:76030693-76030715 GGGTGGAGCTGCTGGGGCTGAGG + Exonic
1099038360 12:77618142-77618164 TGAAGGCTCAACTGGGGCTGGGG - Intergenic
1099589610 12:84570567-84570589 TTCAGGAGAAACTGGGGCTTTGG + Intergenic
1099700428 12:86075801-86075823 AGCTGGAGCAACTGGGTCACAGG + Intronic
1100721977 12:97368935-97368957 TGCTGGAGGGACAGGGGCAGAGG - Intergenic
1101082987 12:101208338-101208360 GGCTGGTTCAACTGGTGCTGGGG - Intronic
1101570394 12:105948285-105948307 AGCTGGAGCCACTGTGGCTCTGG - Intergenic
1101663596 12:106788694-106788716 GGCTGGAGCATCTGGGACTCAGG + Intronic
1101758337 12:107638999-107639021 AGCTGGGGCTACTGGGTCTGGGG + Intronic
1102454878 12:113065186-113065208 AGCTGGAGCAGGTGGGGCAGGGG + Intronic
1102630509 12:114274681-114274703 AGATGGAGCAACAGGAGCTGGGG + Intergenic
1104601433 12:130156454-130156476 GAGAGGAGCAACTGGGGCTGGGG - Intergenic
1104601848 12:130160485-130160507 TGCTGGAGGAAGTCGGGGTGAGG - Intergenic
1104963973 12:132500876-132500898 AGCAGCAGCAACTGGGGCAGGGG - Intronic
1106231345 13:27823542-27823564 TTCTGGGGCAACTGGGGCCTGGG + Intergenic
1106693023 13:32139363-32139385 TCCTGAAGCATCTGTGGCTGGGG - Intronic
1106770567 13:32957497-32957519 AGCTGGCCCAGCTGGGGCTGGGG + Intergenic
1108270572 13:48755814-48755836 AGCTGGAGCAACTGGGACACAGG - Intergenic
1108494010 13:51006659-51006681 TGCTGGAGCCTCTGAGGCTGTGG + Intergenic
1110568567 13:76980205-76980227 TGCTGGGGTATGTGGGGCTGCGG - Intergenic
1111042520 13:82767973-82767995 GGCTGGAGCAACTGGGACATAGG - Intergenic
1111218833 13:85178830-85178852 GGCTGGAGCAACTGGGACACAGG + Intergenic
1114263634 14:21057927-21057949 TGCTGCTGCTTCTGGGGCTGTGG + Exonic
1115468006 14:33737316-33737338 TTCTGAAGCAACTTGGGCTTAGG + Intronic
1115822368 14:37225544-37225566 GGCTGGAGCAACTGGGACACAGG + Intronic
1115834717 14:37388382-37388404 TGCTTGAGCAATTTGGGGTGTGG - Intronic
1118436990 14:65780503-65780525 TGCAGGAGCCACTGGTGCTGAGG - Intergenic
1119040371 14:71269270-71269292 AGCTGAAGCAACTGGGACTCAGG - Intergenic
1119450167 14:74702456-74702478 AGCTGGAGCAACTGGGGCACAGG + Intronic
1119590868 14:75886509-75886531 TGCTGGGACAAGAGGGGCTGAGG - Intronic
1119739803 14:77007032-77007054 AGCTGCAGCAACTGAGGCAGGGG - Intergenic
1120697372 14:87659404-87659426 AGCTGTACTAACTGGGGCTGGGG - Intergenic
1121324417 14:93011679-93011701 TGCAGGGGCACCTGGGGCTGAGG + Intronic
1122843076 14:104476168-104476190 TGGGGGTGCAGCTGGGGCTGTGG - Intronic
1122899582 14:104776829-104776851 GGCTGGTGCAGCGGGGGCTGTGG - Intronic
1122970746 14:105151212-105151234 TGCGGGGGCTGCTGGGGCTGCGG - Intronic
1123110041 14:105862971-105862993 TGATGGAGTAACTGAGCCTGGGG - Intergenic
1123204038 14:106694776-106694798 TGCTGGAGCCACCGGGGGGGGGG - Intergenic
1202905630 14_GL000194v1_random:70394-70416 GGCAGGAGCTACTTGGGCTGAGG - Intergenic
1123841630 15:24253398-24253420 AGCTGGAGCAGCTGGGGCACAGG + Intergenic
1123851513 15:24361991-24362013 AGCTGGAGCAGCTGGGGCACAGG + Intergenic
1124291345 15:28456065-28456087 TGCTGGACCAGCTGGGCCAGGGG - Intergenic
1124609323 15:31197505-31197527 ACCTGGAGCAGCTGGGTCTGAGG + Intergenic
1124623837 15:31297036-31297058 TGGAGGAGCAACAGGGACTGAGG + Intergenic
1124999072 15:34753044-34753066 TCCTGGAGGAACTGGGGGTGGGG - Exonic
1125513913 15:40307543-40307565 TGCTGGAGCACCAGGTGGTGGGG - Intronic
1125806620 15:42498486-42498508 AGCTGGAGCAGCTGGGACTCAGG + Intronic
1126338191 15:47609877-47609899 TGCTGAAGCCACAGGGGCAGTGG - Intronic
1126543153 15:49843955-49843977 AGCTGCATCAACTGGGGCTGCGG - Intergenic
1127473967 15:59314843-59314865 TGCTGGAGGTAGAGGGGCTGAGG + Intronic
1127644295 15:60944639-60944661 TGCTTGAGCAAAAGGGGCAGAGG + Intronic
1127825881 15:62702320-62702342 TGCAGGAGTAACTGGAGTTGTGG + Intronic
1128378644 15:67094975-67094997 TGCTGGAGAAACTGAGGCTCAGG - Intronic
1128751465 15:70153115-70153137 TGATGAGGCACCTGGGGCTGGGG - Intergenic
1128765451 15:70248418-70248440 TTCTGTAGAAAGTGGGGCTGAGG - Intergenic
1129385240 15:75192627-75192649 TGCTGGAGCAGAGGGGGCTGTGG + Intergenic
1129386798 15:75200886-75200908 AGCTGGAGCAGCTGGAGCTGAGG - Intronic
1129455605 15:75674847-75674869 TGATGGAGCCCCTGGGGGTGTGG - Exonic
1129877586 15:78986224-78986246 ATCTGGAGCAGCTGGGGATGGGG + Intronic
1131038658 15:89242961-89242983 GGCTTGAGCGACTGGGGTTGGGG - Intergenic
1132464905 16:72784-72806 TGCGGGGACACCTGGGGCTGGGG + Intronic
1132498046 16:273120-273142 GCCGGGAGCAGCTGGGGCTGTGG - Intronic
1132500682 16:283374-283396 TGCTGGGGCCAGTGGGGCTGGGG + Intronic
1132677417 16:1126534-1126556 AGGGGGAGCAAGTGGGGCTGTGG - Intergenic
1132751335 16:1459245-1459267 TCCTGGGGCTCCTGGGGCTGAGG - Intronic
1132971545 16:2691651-2691673 TCCTGGAGGCACTGGGGCGGCGG + Intronic
1132993103 16:2807543-2807565 AGCTGGAGCACCTCGGGGTGGGG + Intergenic
1133090674 16:3401430-3401452 GGCCGGAGCCACTGGGCCTGCGG + Exonic
1133570353 16:7034360-7034382 TGCTGGAGGAGAGGGGGCTGAGG + Intronic
1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG + Intronic
1135107050 16:19658935-19658957 AGCTGGAGAAACTGAGGCTCAGG + Intronic
1135117910 16:19739140-19739162 TGCAGGTGGAACTGGGGGTGGGG + Intronic
1135854302 16:25992822-25992844 TGCTGGAGCAAGTGTGGCTTGGG - Intronic
1136042062 16:27587315-27587337 AGCTGGAGTAGCTGGGGTTGGGG + Intronic
1136253486 16:29023124-29023146 TGCTGAAGAAACTGAGGCAGAGG - Intergenic
1136707433 16:32201606-32201628 TGCTGGATCAGCTGGGCCAGGGG + Intergenic
1137021428 16:35432203-35432225 TGCTGGAGCAGCTGGAGCCAGGG - Intergenic
1137519224 16:49177946-49177968 TTCTGGAGACTCTGGGGCTGGGG + Intergenic
1138616588 16:58172440-58172462 TGTAGAAGCAACTGAGGCTGAGG - Intronic
1139373006 16:66480072-66480094 TGCTCGAGCCCCTGGGGCAGGGG - Intronic
1139645573 16:68327318-68327340 TGCTAGAGCTCTTGGGGCTGTGG + Intronic
1140178021 16:72684409-72684431 TGGTGGGGCAAAAGGGGCTGAGG + Intergenic
1140481970 16:75266778-75266800 ATCTAGAGCAAGTGGGGCTGGGG + Intronic
1141380117 16:83568768-83568790 TGGAGGAGGAACTGGGACTGAGG - Intronic
1141413341 16:83851492-83851514 TGCTGAAGGAGCTGTGGCTGAGG - Intergenic
1141726506 16:85792700-85792722 TGCAGGAGCCATTTGGGCTGAGG - Intronic
1141865763 16:86748795-86748817 AGCTGGGGTAACTGGGGCAGGGG - Intergenic
1141949529 16:87331660-87331682 TGCAGGGGCAGCTGGGGGTGTGG + Intronic
1142018667 16:87766256-87766278 TTCTGTAGCGACTGGGGGTGGGG - Intergenic
1142150322 16:88509812-88509834 TGCTGGAGTCTCTGGGCCTGTGG + Intronic
1142742291 17:1938092-1938114 AGCTGGAGCAGGTGGGGCTGGGG - Intronic
1142767114 17:2071117-2071139 AGCTGGAGTGACAGGGGCTGGGG + Intronic
1142850419 17:2701890-2701912 TGCGGGAGGCACTGGGGCCGGGG - Intronic
1143457250 17:7076244-7076266 GGCTGGAGAAACAGGGGCAGAGG - Intronic
1144707621 17:17380047-17380069 TACTGGAGAAACTGAGGCTGAGG - Intergenic
1145191208 17:20843035-20843057 TGCTGGATCAGCTGGGTCAGGGG + Intronic
1145750016 17:27349085-27349107 TGCTGGAGCAGCAGTGGCGGCGG + Intergenic
1146207552 17:30917973-30917995 TGAGGGAGCAATTTGGGCTGTGG - Intronic
1147249317 17:39143749-39143771 TGCTGGAGCACGTGGGGAGGAGG + Intronic
1147524837 17:41212792-41212814 TGTTGCAGCAACTGGGGGGGTGG - Intronic
1147557965 17:41491620-41491642 TGCTGGGGCAGCTGGTGCTCTGG - Intronic
1147677922 17:42220079-42220101 TGCTGGGGCAGCTGGGGAGGAGG + Intronic
1147688126 17:42299493-42299515 TGCTGGGGCAGCTGGGGAGGAGG - Intronic
1147701211 17:42396455-42396477 TGATGGAGCAAGTGGGGATGAGG - Intergenic
1148050461 17:44767654-44767676 TGCCGGGGCAGCTGGGGCTGGGG - Intronic
1149427861 17:56572130-56572152 AGCTGTAGCATCTGGAGCTGTGG - Intergenic
1149598577 17:57878559-57878581 TGCTGGGGCTGCTGGAGCTGGGG - Intronic
1149656553 17:58312268-58312290 TGCTGGAGAACCTGGACCTGTGG - Exonic
1150310911 17:64129335-64129357 TCCTTGAGCAAGTGGAGCTGTGG - Intronic
1150941478 17:69698478-69698500 GGCTGGAGCAACTGGGACATAGG + Intergenic
1152405291 17:80094842-80094864 GGGTGGAGGACCTGGGGCTGGGG - Intronic
1152537564 17:80959560-80959582 TGCTGGAGAAGCGGGGGCGGGGG - Intronic
1152811334 17:82384158-82384180 GGCTGAAGCAGCTGGGGGTGTGG - Intergenic
1152855752 17:82663935-82663957 CCCTGGTGCAGCTGGGGCTGGGG + Intronic
1203173683 17_GL000205v2_random:175305-175327 TACTGGAGCAGCTGGAGCTAGGG + Intergenic
1153426899 18:4975035-4975057 GGCTGGAGCAGCTGGGACTCAGG + Intergenic
1154379130 18:13833750-13833772 AGCTGGAGGCACTGTGGCTGAGG + Intergenic
1155217697 18:23657885-23657907 TTCTGGACCAACTCGGGCAGGGG - Intronic
1155667417 18:28328101-28328123 TGCTGCAGCAACTGCCTCTGGGG + Intergenic
1155888442 18:31237436-31237458 GGCTGCAGCAACTGGTGATGGGG - Intergenic
1156148958 18:34222120-34222142 TGCAGAAGCCAGTGGGGCTGGGG - Intronic
1156151814 18:34251971-34251993 GGCTGGTGGAACAGGGGCTGAGG + Intergenic
1156452180 18:37273153-37273175 TGCTGCATCAGCTGGGGCAGAGG + Exonic
1156898816 18:42276904-42276926 TGGAAGATCAACTGGGGCTGAGG + Intergenic
1158259660 18:55592646-55592668 TGCTGGGGCTGGTGGGGCTGGGG - Intronic
1158278036 18:55790199-55790221 AGATGGAGGAACTGGGGGTGGGG - Intergenic
1158334380 18:56399651-56399673 AGCTGGAGAAACTGGGGTTTAGG - Intergenic
1158432206 18:57399640-57399662 TGCTGGGGCAACAGGGGTGGAGG - Intergenic
1158631876 18:59122388-59122410 TGCTGGTGCAAGTGGGTATGAGG + Intergenic
1158920591 18:62187301-62187323 TGCTGGTGCAGCAGAGGCTGAGG + Exonic
1159083414 18:63760677-63760699 TGCTGGAGCAGCTGGGACAGAGG - Intronic
1159567814 18:70074221-70074243 TATTGGAGCCTCTGGGGCTGGGG - Intronic
1159926011 18:74269639-74269661 GGCTGCAGCAACTGGGTGTGTGG - Intronic
1160693488 19:471043-471065 TGGTGGAGAAACTGGGGCTCAGG + Intronic
1160720154 19:593659-593681 TGCTGAAGTCTCTGGGGCTGTGG + Intronic
1160780904 19:877658-877680 TGCTGGGGCACGTGGGTCTGGGG - Intronic
1160780920 19:877714-877736 TGCTGGGGCACGTGGGGCAGGGG - Intronic
1160780946 19:877788-877810 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160780978 19:877900-877922 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781000 19:877968-877990 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781018 19:878030-878052 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781040 19:878092-878114 TGCTGGGGCACGTGGCGCTGGGG - Intronic
1160781083 19:878248-878270 TGCTGGGGCCCGTGGGGCTGGGG - Intronic
1160781100 19:878304-878326 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781122 19:878372-878394 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781149 19:878446-878468 TGCTGGGGCACGTGGGGCCGGGG - Intronic
1160781166 19:878502-878524 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781185 19:878564-878586 TGCTGGGGCATGTGGGGCTGGGG - Intronic
1160781202 19:878626-878648 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781218 19:878682-878704 TGCTGGGGCACGTGGGGTTGGGG - Intronic
1160781255 19:878794-878816 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781280 19:878862-878884 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781315 19:878948-878970 TGCTGGGGCACGTGGAGCTGCGG - Intronic
1160781331 19:879010-879032 TGCTGGGACATGTGGGGCTGGGG - Intronic
1160781351 19:879072-879094 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781376 19:879140-879162 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781434 19:879372-879394 TGCTGGGGCATGTGCGGCTGGGG - Intronic
1160781448 19:879428-879450 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781465 19:879484-879506 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781517 19:879676-879698 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781541 19:879764-879786 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781584 19:879908-879930 TGCTGGGGCACGTGGGGCCGGGG - Intronic
1160994994 19:1878393-1878415 TGCTGGATCAGCTGGGTCAGGGG - Intronic
1161317365 19:3623889-3623911 TGCAGGAGCGGCTGCGGCTGCGG - Exonic
1161398223 19:4055969-4055991 AGCTGGGGAAACTGAGGCTGGGG - Intronic
1161398249 19:4056121-4056143 AGCTGGGGAAACTGAGGCTGGGG - Intronic
1161493881 19:4577253-4577275 AGAGGGAGCAACTGGGGCTAGGG - Intergenic
1161567777 19:5013050-5013072 GGCTGGAGGCTCTGGGGCTGAGG - Intronic
1161628469 19:5339901-5339923 TGCCAGAGCCCCTGGGGCTGGGG + Intronic
1162101782 19:8343231-8343253 TGCGGGCGCGGCTGGGGCTGCGG - Exonic
1162535906 19:11262614-11262636 GGCTGGGGAAACTGAGGCTGGGG + Intergenic
1162535942 19:11262719-11262741 GGCTGGGGAAACTGAGGCTGAGG + Intergenic
1162535975 19:11262834-11262856 GGCTGGAGAAACTGAGCCTGAGG + Intergenic
1163534187 19:17867539-17867561 GGTTGCAGGAACTGGGGCTGGGG - Intergenic
1163552419 19:17973030-17973052 GGCTGGAGGAATTGGGTCTGGGG + Intronic
1164061566 19:21679734-21679756 TGCTGGAGCAGCTCAGGGTGAGG + Intergenic
1164241572 19:23394146-23394168 GGCTGGAGGAACAGGGGATGAGG + Intronic
1164654868 19:29913183-29913205 AGCCTGAGCAATTGGGGCTGTGG - Intergenic
1165484047 19:36084596-36084618 TGGTAGAGCACATGGGGCTGGGG + Intronic
1165762089 19:38327335-38327357 TGCTGGTGCGACTCCGGCTGGGG - Exonic
1165797840 19:38529005-38529027 TGCAGGACCAACTGGTGCAGGGG - Exonic
1166705884 19:44907798-44907820 TGCTGGCGCAGCTCGGGCTCCGG - Exonic
1166790342 19:45395510-45395532 TGTGGGGGCAGCTGGGGCTGTGG + Exonic
1166830896 19:45639181-45639203 TGCTGGGGGAACTGCGGGTGGGG - Intronic
1166944890 19:46390559-46390581 AGGTGGAGCAGCTGGGGCTGGGG + Exonic
1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG + Exonic
1167086997 19:47317107-47317129 TGCTTGAGCCAGAGGGGCTGGGG + Intronic
1167781585 19:51601971-51601993 GGCTAGAGGAAGTGGGGCTGGGG + Intergenic
1168672098 19:58248356-58248378 TGCTGTGGCACCTGAGGCTGGGG - Intronic
925191954 2:1892246-1892268 TGCTGCTGCTGCTGGGGCTGGGG + Exonic
925671017 2:6310024-6310046 AGCTGGGGCAGCTGAGGCTGTGG + Intergenic
926458503 2:13098919-13098941 AACTGGAGCAACTGGGACAGAGG + Intergenic
928048857 2:27968240-27968262 AGCTGAAGCAACTGGGGCGCAGG - Intronic
928106192 2:28471982-28472004 TGCTGGAGGAGCTGGGGCAGCGG - Intronic
928391115 2:30911797-30911819 TGCTAGAGGAACTGGGCATGTGG + Intronic
929552805 2:42905144-42905166 TGCTGAGGCAACTGAGGCTCAGG + Intergenic
929571161 2:43024020-43024042 ACCTGGTGCAACTGAGGCTGAGG + Intergenic
929779227 2:44947053-44947075 TGCTGGTGCTGCTGGGGATGGGG - Intergenic
930186331 2:48415577-48415599 TGCTGGAGCAGCTGATGCTCAGG + Intergenic
931012239 2:57930010-57930032 AGCTGCACCACCTGGGGCTGGGG + Intronic
931406796 2:61987552-61987574 TGCTGGACTACCTGGAGCTGAGG + Intronic
931628279 2:64276573-64276595 TGCTGGCACACCTGGGGATGAGG + Intergenic
932488710 2:72104796-72104818 TGCGGGGGCAACTCGGGCAGGGG + Intergenic
933595800 2:84282275-84282297 CGGTGGAGCAGCTGGGGCTTAGG + Intergenic
933987441 2:87603646-87603668 TGCTGGTGCCTGTGGGGCTGGGG + Intergenic
934500984 2:94860082-94860104 GGCAGGAGCTACTTGGGCTGAGG + Intergenic
934776949 2:96945313-96945335 TGCTCTAGTGACTGGGGCTGAGG - Intronic
935203996 2:100881982-100882004 TGCTGAAACTGCTGGGGCTGGGG + Intronic
935593415 2:104861983-104862005 GGCTGGAGGAGCTGGGGGTGGGG + Intergenic
935817770 2:106863390-106863412 TGCTGCAGAAACTGGGAATGAGG + Intronic
936306398 2:111347162-111347184 TGCTGGTGCCTGTGGGGCTGGGG - Intergenic
936646599 2:114379031-114379053 AGCTGCAGCCACTGGGGGTGAGG + Intergenic
936762856 2:115806843-115806865 TGCTTCAGGAACTGGGGGTGGGG - Intronic
937138519 2:119577034-119577056 TGCTATAGCAGCTGGAGCTGAGG - Intronic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
939135514 2:138288790-138288812 TGCTGGAGCCACTGCTGCTGTGG - Intergenic
939501075 2:142985235-142985257 TGAAGGAGAAACTGGGTCTGTGG + Intronic
940669488 2:156649834-156649856 TGCTGCAATAACTGGAGCTGTGG - Intergenic
941018866 2:160387215-160387237 AGCTGCAGCAGCTGGGGATGCGG + Intronic
941560272 2:167035885-167035907 GGCTGGAGCAGCTGGGACAGAGG - Intronic
943124751 2:183782619-183782641 AGCTGGAGCAGCTGGGACTTAGG - Intergenic
943174497 2:184452795-184452817 TTCTCAAACAACTGGGGCTGAGG - Intergenic
945041474 2:205746626-205746648 TGTGGGAGCCACTGGGGCTCAGG + Intronic
945115516 2:206404610-206404632 TGCTAGAGCAACTGGGAGAGGGG - Intergenic
945618669 2:212106779-212106801 TGCTGGATCACCTGGGGCACAGG - Intronic
946065811 2:216986201-216986223 TCCAGGAGCTACTGGGGCAGGGG - Intergenic
946486769 2:220108111-220108133 TGTTGGAGGAAGTGGGGCAGTGG + Intergenic
946999247 2:225434300-225434322 AGCTGGTGCTACTGTGGCTGTGG - Intronic
947257505 2:228181878-228181900 TCCTCGAGCAACTGAGACTGGGG - Intergenic
947635883 2:231680683-231680705 TCCTGGAGCTGCTGGGGCTCCGG + Intergenic
947820253 2:233064129-233064151 TGCAGGAGCAGCTGGGGCCCGGG + Intronic
948382233 2:237558866-237558888 TGCAGCAGCCACGGGGGCTGGGG + Intergenic
948456602 2:238107350-238107372 TGCTGGAGCAGCGGGTCCTGTGG - Intronic
948761841 2:240197199-240197221 TGCTGGACCAGCTGGGACTGAGG + Intergenic
948808380 2:240462709-240462731 TGCAGGAGGGACTGAGGCTGTGG - Intronic
1168887205 20:1267860-1267882 AGATGGAGAAACTGAGGCTGGGG - Intronic
1168949793 20:1789261-1789283 GGCTGCAGCAGCTGGGGGTGGGG + Intergenic
1169192948 20:3669411-3669433 AGCAGGAGCCCCTGGGGCTGGGG + Intronic
1169328769 20:4699562-4699584 TGCTGCAGCAGCTGGGGCAGTGG + Exonic
1170059495 20:12244542-12244564 TGCTGGAGAAACCGGGAATGAGG - Intergenic
1170536465 20:17345855-17345877 TAAAGGAGCAGCTGGGGCTGGGG + Intronic
1170774025 20:19359628-19359650 GGCTGAGGCACCTGGGGCTGGGG - Intronic
1171399652 20:24864687-24864709 AGCTGGAGCAGCTGGGACTTGGG - Intergenic
1171420493 20:25014265-25014287 TGCCAGAGCTCCTGGGGCTGAGG - Intronic
1171465469 20:25324886-25324908 AGCTGGAGCTAATGGGGATGTGG - Intronic
1171892202 20:30726842-30726864 GGCAGGAGCTACTTGGGCTGAGG + Intergenic
1172463460 20:35137528-35137550 TGCTGGAGTAACAGGGGCCCAGG - Intronic
1172612730 20:36263875-36263897 TCCTGGAGCAGGTGGGGCTGAGG - Intronic
1172634431 20:36400646-36400668 TGATGGGGAAACTGAGGCTGGGG + Intronic
1172961853 20:38805714-38805736 CGCTGGAGCAGCTGCGGCTCGGG + Exonic
1174104244 20:48150839-48150861 TGCTGGCACAACAGGGACTGAGG + Intergenic
1174538761 20:51273309-51273331 AGCAGGAGGAAGTGGGGCTGTGG + Intergenic
1175216068 20:57392130-57392152 TCCTGGAGCAGCGGGGGGTGAGG + Intronic
1175713312 20:61238754-61238776 TGATTGAGAATCTGGGGCTGGGG + Intergenic
1175888959 20:62307655-62307677 TGCTGGAGCAGAAGGGGCTGGGG - Exonic
1176284503 21:5012369-5012391 TGCTGGAGGGACAGGGGCAGGGG + Intergenic
1176329675 21:5536951-5536973 TACTGGAGCAGCTGGAGCCGGGG + Intergenic
1176332482 21:5560877-5560899 TGCTGGGGGATTTGGGGCTGGGG - Intergenic
1176395275 21:6260074-6260096 TGCTGGGGGATTTGGGGCTGGGG + Intergenic
1176398082 21:6284000-6284022 TACTGGAGCAGCTGGAGCCGGGG - Intergenic
1176439075 21:6705104-6705126 TACTGGAGCAGCTGGAGCCGGGG + Intergenic
1176441882 21:6729030-6729052 TGCTGGGGGATTTGGGGCTGGGG - Intergenic
1176463337 21:7032173-7032195 TACTGGAGCAGCTGGAGCCGGGG + Intergenic
1176466144 21:7056099-7056121 TGCTGGGGGATTTGGGGCTGGGG - Intronic
1176486898 21:7413952-7413974 TACTGGAGCAGCTGGAGCCGGGG + Intergenic
1176489705 21:7437877-7437899 TGCTGGGGGATTTGGGGCTGGGG - Intergenic
1176624988 21:9085149-9085171 GGCAGGAGCTACTTGGGCTGAGG - Intergenic
1177479640 21:21669729-21669751 GGCTGGAGCAGCTGGGGCACGGG + Intergenic
1177562608 21:22775895-22775917 TGCTTCAGAAACTGTGGCTGAGG - Intergenic
1178280292 21:31276751-31276773 TCTTGGAGCAAGTTGGGCTGGGG - Exonic
1178329131 21:31671970-31671992 TGCTGGGGCGCCTGCGGCTGTGG + Exonic
1179149683 21:38799182-38799204 TTCTGGACCAACCTGGGCTGGGG - Intergenic
1179630461 21:42674665-42674687 TCCTGGAGGAAATGGGGCAGTGG - Intronic
1179819011 21:43925627-43925649 AGCTGGAGGCGCTGGGGCTGGGG - Intronic
1179872678 21:44251106-44251128 TGCTGGAGGGACAGGGGCAGGGG - Intronic
1180820286 22:18822503-18822525 TGCAGAAGCCACTGGGGCAGTGG - Intergenic
1181121052 22:20668927-20668949 TGCTGGATCAGCTGGGTCAGGGG - Intergenic
1181206511 22:21256975-21256997 TGCAGAAGCCACTGGGGCAGTGG - Intergenic
1181475318 22:23164476-23164498 TGCTGCATCAACTTGGGGTGGGG - Intergenic
1182281262 22:29218951-29218973 TGCAGGAGGATCTGGGGCAGGGG - Intronic
1183419272 22:37701227-37701249 AACTGGGGCAACTGGGGCTGGGG + Intronic
1183628411 22:39018610-39018632 GGCTGGAGGAACGGGGTCTGTGG - Exonic
1183742662 22:39677465-39677487 TGCAGGAGGAACTGGGGGGGCGG + Intronic
1183984500 22:41562088-41562110 TGCTGCATCCACTGGGGCTGGGG + Intronic
1184106098 22:42368412-42368434 AGCTGGAGAAACTGCAGCTGAGG - Intergenic
1184421869 22:44386842-44386864 TGCAGGAGCTACTGAGCCTGGGG - Intergenic
1184466623 22:44672246-44672268 TGCTGGGGCAAGTGGGGATGGGG + Intronic
1184533235 22:45070282-45070304 GGCAGAAGCAGCTGGGGCTGAGG + Intergenic
1184556735 22:45237243-45237265 TGCTGGAAGCAGTGGGGCTGCGG - Intronic
1185400013 22:50610812-50610834 TCCAGGCGCAGCTGGGGCTGAGG + Exonic
1185402723 22:50627097-50627119 TGCGGGAGCATCAAGGGCTGGGG + Intronic
1203220409 22_KI270731v1_random:38448-38470 TGCAGAAGCCACTGGGGCAGTGG + Intergenic
1203270416 22_KI270734v1_random:48378-48400 TGCAGAAGCCACTGGGGCAGTGG - Intergenic
949348816 3:3102934-3102956 CGCAGGAGCAACTGTGTCTGTGG - Intronic
950499575 3:13355078-13355100 AGCTGGAGAAACTGAGGCTCAGG - Intronic
950604310 3:14064794-14064816 TGCTGGAGCTGCTGCTGCTGGGG - Exonic
953923648 3:46969146-46969168 TGCTGGAGGAACAGAGGCAGTGG - Intronic
955320604 3:57971766-57971788 AGGTGGAGCAACTGAGGCTCAGG + Intergenic
955916497 3:63912725-63912747 TGCTGCTGCCGCTGGGGCTGCGG - Exonic
956500343 3:69876269-69876291 TGCTGTAGCAAATGCAGCTGTGG - Intronic
956931444 3:74048022-74048044 TGTTTCAGCAGCTGGGGCTGTGG - Intergenic
957083096 3:75655553-75655575 TGCTGGGCCAGCTCGGGCTGGGG + Intergenic
957890080 3:86345604-86345626 TGCTGAACCACCTGGAGCTGGGG + Intergenic
958091324 3:88880174-88880196 GGGTGCAGCAACTGGGACTGTGG + Intergenic
958474899 3:94568685-94568707 AGCTGGAGCATCTGGGACTCAGG - Intergenic
959809208 3:110595056-110595078 AGCTGGAGCCAGAGGGGCTGGGG + Intergenic
960581427 3:119282560-119282582 GGCTGGAGCAGCTGGGACTGAGG - Intergenic
960801586 3:121545704-121545726 TCCTGGAGCACCTGCAGCTGCGG + Exonic
961056494 3:123793473-123793495 TGCTGGAGAACTTGGGGGTGGGG - Intronic
961067988 3:123892337-123892359 AGCTGGAGCAGCTGGGACTCAGG + Intergenic
961543019 3:127613027-127613049 TCCTGGAGTAACTGGGTCAGCGG + Intronic
961746510 3:129067064-129067086 TGCTGGAGCAATTGCGCCAGAGG - Intergenic
963779813 3:149475877-149475899 TGCTGCGGCAACGAGGGCTGTGG + Exonic
964569359 3:158095105-158095127 TGCTGGAGGATGTGGGGCTTTGG + Intergenic
964887856 3:161504739-161504761 TGCTGGAGCAGGTGGGGATTTGG + Intergenic
965045471 3:163572274-163572296 GGCTGGAGCAACTGGGACAGAGG - Intergenic
965112311 3:164443405-164443427 AACTGGAGCAACTGGGGCAGGGG + Intergenic
966059257 3:175734715-175734737 GGCTGGAGCAGCTGGGACTCAGG + Intronic
966517126 3:180830183-180830205 TGCTGCAGCAGCAGAGGCTGAGG - Intronic
966722670 3:183079963-183079985 AGCTGGAGCAGCTGGGACTGAGG + Intronic
966733362 3:183168741-183168763 GGCTGGAGCAGCTGGGACAGAGG + Intergenic
967244248 3:187470270-187470292 GGGTGGAGGAACAGGGGCTGAGG + Intergenic
967449432 3:189606627-189606649 TGGTGGTGCAACGGAGGCTGAGG - Intergenic
967525973 3:190493119-190493141 TGCTGGAGGAATTTGGGCTGGGG - Intergenic
967807728 3:193730260-193730282 TTCTTTACCAACTGGGGCTGAGG + Intergenic
967875549 3:194266039-194266061 TTCTGGTGCACCTGGGGCCGAGG - Intergenic
967965383 3:194956480-194956502 AGCTGGAGCACCTGGGGCCCAGG - Intergenic
968284860 3:197502544-197502566 AGCTGGAGCACCTGTGGCTGTGG - Intergenic
968699381 4:2047414-2047436 CGCGGGGGCAACTGGGGCAGGGG + Intergenic
969322961 4:6424149-6424171 AGCTGGAGCTCCAGGGGCTGAGG - Intronic
970361230 4:15310754-15310776 GGCTGGGGCAACTGGGGCACAGG - Intergenic
971948660 4:33315234-33315256 GGCTGGAGCAGCTGGGACTATGG - Intergenic
972822435 4:42717024-42717046 TGCTGGCCCAGCTGGTGCTGGGG + Intergenic
973327333 4:48877192-48877214 TGCTGAACCTCCTGGGGCTGGGG + Intergenic
973605102 4:52579067-52579089 TGCTGGTGCTGCTGGTGCTGGGG + Intergenic
974448543 4:62018739-62018761 TCCTGCTGGAACTGGGGCTGAGG + Intronic
975973660 4:80072344-80072366 CACTGGATCAGCTGGGGCTGAGG - Intronic
976259908 4:83135667-83135689 GGCTGGAGCAGCTGGGCCTCAGG + Intronic
977417307 4:96749483-96749505 TGCTGGAGCAGCTGGGGTGTAGG + Intergenic
978945464 4:114490638-114490660 TCCTGGACATACTGGGGCTGGGG - Intergenic
981175435 4:141677532-141677554 TCCTTGAACAACTCGGGCTGGGG - Intronic
982170288 4:152655446-152655468 TGCTGCAGCCACTAGGGCTCAGG - Intronic
982215598 4:153080293-153080315 TGCTGCTGCTACTGGTGCTGGGG - Intergenic
982524998 4:156466955-156466977 AGCTGGAGCAGCTGGGACTCAGG + Intergenic
982768711 4:159376378-159376400 AACTGGAGAAGCTGGGGCTGGGG + Intergenic
983178788 4:164623226-164623248 GGCTCTAGCAGCTGGGGCTGAGG + Intergenic
983341148 4:166462927-166462949 TGCTGCAGCTACTGGTGATGGGG - Intergenic
983462896 4:168048862-168048884 TGCTGGAGCAGCTGGGACACAGG - Intergenic
984232121 4:177112183-177112205 GGCTGGAACAACTGGGACTCAGG + Intergenic
985394284 4:189525550-189525572 GGCTGGAGCAGCTGGGACTCAGG - Intergenic
986323275 5:6651091-6651113 TGCTGGGGGAATTGGGGGTGGGG + Intronic
987401878 5:17486414-17486436 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987403124 5:17498412-17498434 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405305 5:17518548-17518570 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405750 5:17521982-17522004 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987406197 5:17525416-17525438 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987407502 5:17585555-17585577 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408200 5:17590757-17590779 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408648 5:17594191-17594213 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987409104 5:17597625-17597647 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987412893 5:17632269-17632291 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987413167 5:17634641-17634663 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987414550 5:17649227-17649249 TGCAGGAGGAACTGAGGCTGAGG - Intergenic
987610654 5:20198818-20198840 AGCTGGAGCAACTGGGTCACAGG - Intronic
987661810 5:20887999-20888021 GGCTGGAGCAGCAAGGGCTGGGG + Intergenic
987802901 5:22721198-22721220 AGCTGGAGCAGCTGGGGCACAGG - Intronic
987927761 5:24364453-24364475 TGCTGGAGCAAATGTGGTGGTGG - Intergenic
988520929 5:31945139-31945161 TTCTGGAGCTGCTTGGGCTGCGG - Intronic
988761773 5:34317320-34317342 GGCTGGAGCAGCAAGGGCTGGGG - Intergenic
991104952 5:62833063-62833085 GGCTGGAGCAGCTGGGACTTAGG + Intergenic
991340344 5:65601871-65601893 AGCTGGAGCAGCTGGGACTCAGG + Intronic
991464746 5:66898874-66898896 TGCTGGAGTAAGTTGTGCTGTGG + Intronic
992311974 5:75510967-75510989 TGCTGCAGCGACTAGGGATGAGG - Intronic
992609685 5:78496554-78496576 TGCTGGGTCAACAAGGGCTGGGG - Intronic
992763186 5:79969901-79969923 GGCTGGGACCACTGGGGCTGGGG - Intergenic
995369606 5:111404401-111404423 AGCTGGTGAAACAGGGGCTGAGG + Intronic
997046932 5:130330155-130330177 AGCTGGAGCAGCTGGGGCACAGG - Intergenic
997119093 5:131156088-131156110 TGAAGGCTCAACTGGGGCTGGGG + Intergenic
998040165 5:138946511-138946533 TGCTGGAGCAATGGGTGCCGGGG - Intergenic
999294009 5:150446727-150446749 TGCTGGAGCACCTGGATTTGAGG - Intronic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1001065066 5:168529559-168529581 GGCTGGGGCAGCTGGGGCGGGGG + Exonic
1001411536 5:171515736-171515758 GGCTGGTGGAAATGGGGCTGAGG - Intergenic
1001513038 5:172337043-172337065 TTATGGAGCAACGGGAGCTGAGG - Exonic
1001635323 5:173206013-173206035 GGGTTGAGCCACTGGGGCTGTGG - Intergenic
1001893834 5:175362043-175362065 AGCTGAAGCAGCTGGGGCTCCGG + Intergenic
1002076990 5:176714216-176714238 GCCTGGATCAACTAGGGCTGTGG - Intergenic
1002334227 5:178466937-178466959 AGCTGGGGAAACTGAGGCTGTGG - Intronic
1002459385 5:179365398-179365420 GGGTGCAGCCACTGGGGCTGGGG - Intergenic
1002474100 5:179454196-179454218 GCCTGGAGCAGGTGGGGCTGGGG - Intergenic
1003052101 6:2789222-2789244 TGCTGGAGCACGCGGTGCTGGGG + Intergenic
1003191908 6:3881692-3881714 TGCACAAGAAACTGGGGCTGGGG - Intergenic
1003325893 6:5090534-5090556 TTCAGGAGCAACTGGGAATGGGG + Intergenic
1003459426 6:6316827-6316849 TGATGGAGAAACTGAGGCTTGGG + Intronic
1003624150 6:7727259-7727281 TGCCGGAGCGCCGGGGGCTGCGG - Exonic
1006336747 6:33425065-33425087 GGGTGGTGGAACTGGGGCTGGGG + Intronic
1006512720 6:34530315-34530337 TGCCGGGGCCACTGGTGCTGCGG - Exonic
1007179150 6:39915827-39915849 TCCTGGGCAAACTGGGGCTGGGG + Intronic
1007280790 6:40710726-40710748 GGCTGGAGAAACTGAGGGTGGGG + Intergenic
1009693721 6:67069163-67069185 AGCTCGAGCAGCTGGGGCAGAGG - Intergenic
1010458225 6:76083037-76083059 GGCTGGAGCAGCTGGGACTCAGG + Intergenic
1010868179 6:81006240-81006262 AGCTGGAGCAACTGGGACATAGG - Intergenic
1011033314 6:82945234-82945256 TGCTGAGCCACCTGGGGCTGAGG - Intronic
1011218911 6:85033687-85033709 TGCTGGAGCAGCTGGGACTCAGG + Intergenic
1012045170 6:94263967-94263989 GGCTGGAGCAACTGGGACACAGG + Intergenic
1012515330 6:100052943-100052965 TTCTAGAGGAAGTGGGGCTGAGG + Intergenic
1013265571 6:108494184-108494206 TGCTGGACTCACTGGGGCAGGGG - Intronic
1013947206 6:115735821-115735843 AGCTGGAGCAGCTGGGGCACAGG - Intergenic
1014345288 6:120262691-120262713 GGCTGGGGCAGCTAGGGCTGTGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1017640645 6:156490670-156490692 GGCTGGAGCATCTGGGACTCAGG - Intergenic
1017721507 6:157246405-157246427 TGCGGGAGAAAGTGGGTCTGGGG - Intergenic
1017946573 6:159100922-159100944 TGGTGGAGCAAATGGGGGTTGGG + Intergenic
1018867881 6:167759608-167759630 TGCTGGTGGAACGGGGGCTCTGG + Intergenic
1019139414 6:169934144-169934166 TGCTGAAGCACCTTTGGCTGTGG + Intergenic
1019352392 7:560762-560784 TGCTGGAACTCCTGGAGCTGGGG - Intronic
1019926392 7:4195924-4195946 TGGTGGAGAGACTTGGGCTGAGG - Intronic
1020092421 7:5349067-5349089 TTCTCAAGCAGCTGGGGCTGCGG + Intronic
1022549683 7:31227239-31227261 GGCTGGAGCAACTGGGACACAGG - Intergenic
1023664778 7:42511825-42511847 TGCTGGAGCAGCAGGGGCCTGGG - Intergenic
1024289770 7:47794349-47794371 GGCTGGAGCAACTGGGACACAGG - Intronic
1024544978 7:50509468-50509490 TGCTGGAGCAAGTTGGGCCGAGG - Intronic
1024573702 7:50747080-50747102 CGCTGCAGAAACTGGGGCTTTGG - Intronic
1024965161 7:55018191-55018213 TGCGGGAGCTACAGGGGCAGTGG + Intergenic
1025035033 7:55588604-55588626 TGCTGGGGCAGATGGAGCTGAGG + Intergenic
1025191558 7:56899463-56899485 TGCTGGAGCATGTGGGGCTGAGG - Intergenic
1025680389 7:63677471-63677493 TGCTGGAGCATGTGGGGCTGAGG + Intergenic
1026852864 7:73735805-73735827 TGGAGGAGAAACTGAGGCTGAGG + Intergenic
1026941879 7:74291809-74291831 AGCAGGGACAACTGGGGCTGTGG - Intronic
1026955482 7:74373852-74373874 GGCTGAAGGACCTGGGGCTGAGG + Intronic
1027189284 7:75988369-75988391 TACTGCAGCGACTGGGGATGGGG + Intronic
1029609895 7:101621278-101621300 TGCTGGAGCATCTGGGGCAGGGG + Intronic
1029668136 7:102008997-102009019 TGCTGGAGCACGCGGGGCCGAGG - Intronic
1030065460 7:105655780-105655802 TCCCGGAGCAACTGGGGCTGAGG - Intronic
1030191717 7:106817199-106817221 TGCTGGTGCCACTGGGGGTGGGG - Intergenic
1031109939 7:117596156-117596178 CGCTGGGGGAACTGGGGCTGCGG + Intronic
1031145707 7:117994993-117995015 GGCTGGAGCAGCTGGGACAGAGG - Intergenic
1031288963 7:119908255-119908277 TGCTGGAGCAGCTGGGACACAGG + Intergenic
1031484044 7:122307182-122307204 TGCTGGGGCAAAGGGGGGTGGGG + Intronic
1031862400 7:126995020-126995042 TGCTGAACCACCTGGAGCTGGGG - Intronic
1032238064 7:130141478-130141500 TGCTGGCGCAGCGGGGCCTGGGG - Intergenic
1032579637 7:133092279-133092301 TGCAGCAGCTACTGGAGCTGTGG + Intergenic
1032872183 7:135998063-135998085 GGCTGATGCAACTGGGGATGAGG - Intergenic
1033905224 7:146193542-146193564 GGCTGGAGCAGCTGGGGCAGAGG + Intronic
1034115800 7:148582760-148582782 TGCTGGAGCCGCTAGGGCTCAGG + Intergenic
1035013298 7:155740003-155740025 TGCCGGAGCCCCTGGCGCTGGGG - Exonic
1036457731 8:8924449-8924471 TGCTGGAGCAGCTGGGACACAGG + Intergenic
1037882605 8:22580293-22580315 TGCTGGAGCATGGGGGGCAGGGG - Intronic
1037919082 8:22791217-22791239 TCCTGGAGAAGCTCGGGCTGAGG + Intronic
1038645392 8:29357262-29357284 TGCTCGGGCAGGTGGGGCTGTGG - Intergenic
1042180256 8:66080434-66080456 TGCTGCTGCAACTGCTGCTGTGG + Exonic
1043969632 8:86514843-86514865 CGCTCGCGCACCTGGGGCTGGGG + Intronic
1043993108 8:86780548-86780570 GGCTGGAGCAACTAGGACTCAGG - Intergenic
1046878199 8:119278791-119278813 TGCTGGAACAACTGGGATTTCGG + Intergenic
1048697955 8:137049780-137049802 TGCTGGAGCTGCTGGAGCTGGGG - Intergenic
1049287203 8:141782293-141782315 CTCTGGAGCAACAGCGGCTGCGG - Intergenic
1049361950 8:142216127-142216149 GTCTGGAGGAGCTGGGGCTGAGG - Intronic
1049488095 8:142876820-142876842 GGCTGGCAGAACTGGGGCTGTGG + Exonic
1049492982 8:142914843-142914865 GGCTGGCAGAACTGGGGCTGTGG + Exonic
1049823108 8:144648159-144648181 TGGAGGAGCAGCTGGGGCCGTGG - Intergenic
1050773633 9:9234292-9234314 AGCTGAAGCAACTGGGGCACAGG + Intronic
1050879002 9:10675673-10675695 AGCTGCAGCCACTGGTGCTGGGG + Intergenic
1051186561 9:14466777-14466799 TGGTGGGGGAGCTGGGGCTGAGG + Intergenic
1051278420 9:15418715-15418737 ACTTGGAGCTACTGGGGCTGAGG - Intergenic
1051986578 9:23096502-23096524 AGCTGAAGCAGCTGGGGCTCAGG - Intergenic
1052295463 9:26892567-26892589 TGCGGGAGCGCCGGGGGCTGCGG - Exonic
1054356618 9:64068863-64068885 GGCAGGAGCTACTTGGGCTGAGG - Intergenic
1056554616 9:87678165-87678187 TGCTGGGGCAGCTGGGGTGGAGG - Intronic
1057052458 9:91935960-91935982 TTGTGGAGTAGCTGGGGCTGCGG - Intronic
1057217231 9:93235826-93235848 TGCAGGTGCACCAGGGGCTGTGG + Intronic
1057511650 9:95684846-95684868 TGCTGGCAAATCTGGGGCTGGGG - Intergenic
1057900592 9:98944838-98944860 TGCTGGAGAAACTGAGGCCCGGG - Intronic
1058248964 9:102668256-102668278 TTCTGAACCACCTGGGGCTGAGG + Intergenic
1058896112 9:109401893-109401915 TTCTGCAGCAACTGGAGGTGAGG - Intronic
1059450916 9:114371000-114371022 AGATGGAGGAACAGGGGCTGGGG + Intronic
1059711085 9:116868275-116868297 AGCTGGAGAAACAGGGGCTTAGG + Intronic
1060217191 9:121745550-121745572 TGCAGGAGCATGTGGGGCTATGG - Intronic
1060267585 9:122121386-122121408 TGCTGGAGCCCAAGGGGCTGGGG - Intergenic
1060966539 9:127715114-127715136 TGCTGGGGCAGCTGGCGCGGCGG - Exonic
1061232885 9:129325205-129325227 CACTGGAGCACCTGGGGCTCAGG - Intergenic
1061411782 9:130425819-130425841 TGCTGCACCAGCTGGGGCTGGGG - Exonic
1061731148 9:132615021-132615043 TGCAGAAGGAACAGGGGCTGTGG + Intronic
1061785138 9:133023319-133023341 TGCTGGGGCAACTGAGGGCGGGG + Intergenic
1061809856 9:133155904-133155926 TGCTCCAGCAGCTTGGGCTGAGG + Exonic
1062532808 9:137009235-137009257 GGCTGGGGGCACTGGGGCTGGGG - Intronic
1062580940 9:137229000-137229022 GGCTGGGGGAAGTGGGGCTGGGG - Exonic
1062669518 9:137699071-137699093 TGCTGGTGCAGGTGCGGCTGAGG + Intronic
1203429610 Un_GL000195v1:79455-79477 TGCTGGGGGATTTGGGGCTGGGG + Intergenic
1203432420 Un_GL000195v1:103375-103397 TACTGGAGCAGCTGGAGCCGGGG - Intergenic
1186765626 X:12767953-12767975 AACTGGAGCCACAGGGGCTGGGG + Intergenic
1188794237 X:34442198-34442220 GGCTGGAGCAGCTGGGACCGAGG + Intergenic
1189081294 X:37975375-37975397 TACTGGAGCAGCAGGGACTGAGG + Intronic
1189637224 X:43023737-43023759 GGCTGGAGCAGCTGGGACTCAGG + Intergenic
1189870927 X:45381931-45381953 TGCTGCTGCAGCTGGTGCTGGGG - Intergenic
1191600665 X:63001603-63001625 TGCTGCAGCCACTGTGGATGAGG + Intergenic
1192155654 X:68744659-68744681 TGCTGGAGACACTGGGGCAGAGG - Intergenic
1192267895 X:69552540-69552562 TGCTGGAGCAGCTGGGGCCCTGG - Intergenic
1192336702 X:70227412-70227434 TACTGTAGCTGCTGGGGCTGCGG - Intergenic
1192359747 X:70431994-70432016 GGCTGAAGGAGCTGGGGCTGTGG + Intronic
1192442767 X:71186927-71186949 TGCTTGAGAAACTGGGCCTGTGG + Intergenic
1193388170 X:80895073-80895095 AGCTGGAGCAGCTGGGACTCAGG - Intergenic
1193807982 X:86016467-86016489 GGCTGGAGCTGCTGGGGCTCAGG - Intronic
1195240566 X:102947596-102947618 TGCTGGTGGAACAGGGGCTGGGG + Intergenic
1195433688 X:104817916-104817938 AGCTTGAGCAACTGGTCCTGTGG + Intronic
1196022299 X:111002973-111002995 CCCTGGACCAACTGGGGCTGGGG + Intronic
1196556538 X:117091249-117091271 TGCTTGAGCAAGGGAGGCTGAGG - Intergenic
1197562030 X:128035178-128035200 TGCTGAATCACCTGGGGCTGAGG - Intergenic
1198773668 X:140156608-140156630 TTCTGAACCAACTGGAGCTGGGG - Intergenic
1199202083 X:145103425-145103447 TGCTGGATCAACTGTGGTGGTGG + Intergenic
1200061987 X:153487851-153487873 TGGTGGAGACACTGGGTCTGCGG + Intronic
1200230714 X:154442683-154442705 GGCTGGGGCAGCAGGGGCTGGGG - Exonic
1200853534 Y:7911323-7911345 TGCTGGAGCACATAGGGCTGAGG - Intergenic
1202038968 Y:20663237-20663259 AGCTGCATCATCTGGGGCTGCGG - Intergenic
1202266144 Y:23021224-23021246 TGCTGGAGCAGTTAGGGCTCAGG + Intergenic
1202419137 Y:24654967-24654989 TGCTGGAGCAGTTAGGGCTCAGG + Intergenic
1202451649 Y:25015117-25015139 TGCTGGAGCAGTTAGGGCTCAGG - Intergenic