ID: 1167045411

View in Genome Browser
Species Human (GRCh38)
Location 19:47046281-47046303
Sequence CCCAGACCATCCCCCGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 461}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167045411_1167045418 11 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045418 19:47046315-47046337 GGTTGAGGAGACAGGAACAGAGG 0: 1
1: 0
2: 1
3: 44
4: 515
1167045411_1167045414 -10 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045414 19:47046294-47046316 ATGGTCTGGGAGCAAAGCCAGGG 0: 1
1: 0
2: 3
3: 18
4: 245
1167045411_1167045416 3 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045416 19:47046307-47046329 AAAGCCAGGGTTGAGGAGACAGG 0: 1
1: 0
2: 0
3: 28
4: 320
1167045411_1167045423 28 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045423 19:47046332-47046354 CAGAGGCAGGGCCGTGCCAGGGG 0: 1
1: 0
2: 7
3: 58
4: 375
1167045411_1167045422 27 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045422 19:47046331-47046353 ACAGAGGCAGGGCCGTGCCAGGG 0: 1
1: 0
2: 2
3: 41
4: 434
1167045411_1167045421 26 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045421 19:47046330-47046352 AACAGAGGCAGGGCCGTGCCAGG 0: 1
1: 0
2: 4
3: 35
4: 341
1167045411_1167045415 -4 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045415 19:47046300-47046322 TGGGAGCAAAGCCAGGGTTGAGG 0: 1
1: 0
2: 4
3: 37
4: 346
1167045411_1167045420 16 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045420 19:47046320-47046342 AGGAGACAGGAACAGAGGCAGGG 0: 1
1: 0
2: 6
3: 152
4: 1226
1167045411_1167045419 15 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045419 19:47046319-47046341 GAGGAGACAGGAACAGAGGCAGG 0: 1
1: 0
2: 4
3: 129
4: 1099

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167045411 Original CRISPR CCCAGACCATCCCCCGACCT TGG (reversed) Intronic