ID: 1167045416

View in Genome Browser
Species Human (GRCh38)
Location 19:47046307-47046329
Sequence AAAGCCAGGGTTGAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167045411_1167045416 3 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045416 19:47046307-47046329 AAAGCCAGGGTTGAGGAGACAGG 0: 1
1: 0
2: 0
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167045416 Original CRISPR AAAGCCAGGGTTGAGGAGAC AGG Intronic
900427282 1:2586511-2586533 AAGGCCCGGATTGAGGAGGCGGG + Intronic
901427457 1:9191519-9191541 AGAGCCAGGCTTCTGGAGACGGG - Intergenic
901438884 1:9265498-9265520 ACAGCCAGGATGGAGGAGACAGG - Exonic
901759083 1:11459098-11459120 AAAGCCTGGGATGAGGGGAGGGG - Intergenic
901790725 1:11652622-11652644 AGAGCCAGTGAGGAGGAGACGGG + Intronic
902214814 1:14927849-14927871 AAACCCGCGGTTGAGGGGACTGG + Intronic
903330605 1:22595198-22595220 AAAGCCAGGGTTGGGGGACCAGG - Intronic
904768916 1:32870438-32870460 AAACCCAGGGCTGAGGTGACAGG + Intronic
905238125 1:36564434-36564456 ATAGACAGGGATCAGGAGACAGG - Intergenic
905544981 1:38790483-38790505 AGAGGCAGGGGAGAGGAGACAGG + Intergenic
907406949 1:54259482-54259504 GATGCCAGGGATGAGGAGACAGG + Intronic
907583770 1:55595987-55596009 CAAGCCAGGGATGGGAAGACAGG - Intergenic
907691630 1:56673025-56673047 AAGGCCAAAGTTGACGAGACTGG + Intronic
908392860 1:63699259-63699281 TAAGCCAGGCTTGAGGCGAAGGG - Intergenic
908949073 1:69537408-69537430 AAAGCTAGGGTTGGGGAAAGAGG + Intergenic
910427780 1:87133039-87133061 CAAGCCTGGGTAGAGGAGAACGG + Intronic
910710452 1:90174437-90174459 AAAGCCAAGGTTGAGGAGTTTGG + Intergenic
911201021 1:95043797-95043819 AAAGAGAGGGTTGAAGAGAGAGG + Intronic
912376451 1:109213652-109213674 TAAGCTAGGGATGAGGGGACAGG + Intergenic
912974377 1:114314653-114314675 AAAGCCAAGTTGGAGGAGAGGGG + Intergenic
913394077 1:118347078-118347100 AAAGCCAGTCATGAGGAGAAGGG - Intergenic
913547701 1:119885773-119885795 AAAGCCAAGAATGATGAGACTGG - Intergenic
915141010 1:153768584-153768606 AAAGCCAGAGCTGAGAGGACTGG - Intronic
915229590 1:154435663-154435685 CAAGCCCGGGAAGAGGAGACTGG - Intronic
915973218 1:160368171-160368193 AAAGCCAGGGCTGGGGAGGAAGG + Intronic
916828234 1:168463965-168463987 AAAACCAGGTTTCAGGAGATGGG - Intergenic
920288798 1:204901772-204901794 AAAGGAAAAGTTGAGGAGACAGG + Intronic
920404707 1:205700683-205700705 AATGCCAAAGTTGAAGAGACTGG - Intergenic
924009048 1:239644342-239644364 AGAGCCAGGGGTGGGAAGACGGG - Intronic
924384627 1:243489797-243489819 AAAGCCTGGGCTGTGGAGTCAGG - Intronic
924493261 1:244560809-244560831 ATAGACAGGGTTGAGTATACAGG + Exonic
1063666077 10:8061505-8061527 ACAGGCAGGGGTGAGGAGAGGGG + Intronic
1065299181 10:24305388-24305410 AAGGAGAGGGTTGAGGTGACAGG + Intronic
1066507830 10:36063806-36063828 AAAGGCAGGATTGAGAAGATAGG - Intergenic
1066698902 10:38105334-38105356 CAAACCAGAGCTGAGGAGACAGG - Intronic
1066993751 10:42542899-42542921 CAAACCAGAGCTGAGGAGACAGG + Intergenic
1067978719 10:51056567-51056589 AAGCCTAGGGTTAAGGAGACAGG - Intronic
1068868304 10:61917781-61917803 AAAGCCAGGGCTCTGGAGTCTGG + Intronic
1069656878 10:70096555-70096577 ATAGCCAGGGTGGAGGAGCTTGG + Intronic
1069714967 10:70514782-70514804 AGGGCCAGGGTTAAGGACACGGG + Intronic
1069822163 10:71234899-71234921 AAAAGCTGGGTTGAGGGGACAGG + Intronic
1070702393 10:78613326-78613348 AAAGGGAGGGAGGAGGAGACAGG + Intergenic
1070788748 10:79177335-79177357 AAAGACAGGGCCGAGGAGCCTGG - Intronic
1070948721 10:80413812-80413834 ATATCCAGGGGTGAGCAGACGGG - Intronic
1071377483 10:85023687-85023709 AAATCCAGAGTTGAAGACACTGG - Intergenic
1073284166 10:102377209-102377231 AAAGCCAGGGCTGAGGGGAAGGG + Intronic
1073422773 10:103437903-103437925 ATAGGCAGGAGTGAGGAGACAGG - Intronic
1075344119 10:121669906-121669928 AAGGCCAGGGAAGAGGAGAGAGG + Intergenic
1076118383 10:127917040-127917062 AAAGCCAGAATGGAGGTGACGGG + Intronic
1077041130 11:523635-523657 AAAGCCGGGGTTGGGGGGCCGGG + Intergenic
1077949640 11:6942290-6942312 AAAGACAAGGTTGAGGATGCTGG + Intronic
1078026510 11:7700688-7700710 AAAGCCATGGATGAGGAAAAGGG - Intronic
1079417955 11:20257789-20257811 AGTGTCAGGGTTGAGGATACTGG + Intergenic
1080618075 11:33962208-33962230 AAAGCCAGGAATCAGGAGCCAGG + Intergenic
1080816844 11:35766376-35766398 AAGGCCAGGGTAGAGCAGAAGGG + Intronic
1084153450 11:67301852-67301874 CAAGCCAGGGCTGGGGGGACAGG - Intronic
1085790479 11:79493467-79493489 AAAGCCAGGGTTGACCTTACAGG + Intergenic
1085921698 11:80965178-80965200 AAAGCCATGGTTGAAGAGCTAGG - Intergenic
1086815935 11:91370643-91370665 AAAGGGAGGGTTGAGGAGCTGGG + Intergenic
1087671720 11:101114757-101114779 TGAGCCAGGGTTGTGGAGAGAGG - Intronic
1088908139 11:114170242-114170264 AAAGCCTAGGTTGAGAAGACAGG + Intronic
1089014367 11:115154386-115154408 AATGCCTGGGTACAGGAGACAGG + Intergenic
1090327238 11:125899638-125899660 AAAGCCAGTGATGAAGAGAAAGG + Exonic
1090397963 11:126431709-126431731 AAGACCAGGGTGGAGGACACAGG + Intronic
1091694568 12:2619148-2619170 CCAGCCAGGGCTGAGCAGACGGG + Intronic
1092035337 12:5329614-5329636 AAGGCCAAGGTTGATGAGAGTGG + Intergenic
1093330852 12:17836616-17836638 AAAACCTAAGTTGAGGAGACTGG - Intergenic
1095966430 12:47870269-47870291 AGAGCCAGGGTTGGGCAGTCTGG - Intronic
1097494637 12:60315370-60315392 TATACCAAGGTTGAGGAGACAGG + Intergenic
1097695472 12:62770885-62770907 AAAGCAAGGGTCCAGGAGCCGGG + Intronic
1099304956 12:80942207-80942229 AAAGCCAGGGATGAGGAAGCAGG + Intronic
1101850061 12:108394536-108394558 GAAGCCAGGCTTGGAGAGACTGG - Intergenic
1102761264 12:115387305-115387327 AAAGCCAGATTTGAGCAGAAGGG - Intergenic
1103921575 12:124402181-124402203 AAAGCGAGGGCGGAGGAGAGGGG + Intronic
1104625571 12:130351373-130351395 GAAGCCTGGGCAGAGGAGACTGG - Intronic
1104974414 12:132546062-132546084 CACGCCAGGGCTGAGGGGACCGG - Intronic
1107812853 13:44216788-44216810 AAAGCAAGGGTTGAGAACAGGGG + Intergenic
1108019034 13:46106451-46106473 AAAGACAGGGTAGAAGAGACAGG + Intergenic
1109861496 13:68205281-68205303 GAGGCCAGGGGTGAGGAGCCTGG - Intergenic
1110092571 13:71471299-71471321 AAAGGCAGGCTTGGGGAGAGGGG + Intronic
1110454065 13:75670108-75670130 AAAGGCAGGGAGGAGGAGAGAGG - Intronic
1110891601 13:80704567-80704589 AGAGCCGGGGGTGGGGAGACCGG - Intergenic
1111503641 13:89158422-89158444 AAAGACAGGGTTGGGGAGAGAGG - Intergenic
1111665926 13:91267636-91267658 TAAGCCACGGTTTAGGAGACCGG + Intergenic
1112927471 13:104694275-104694297 AAAGCCAGTGATGAGGAGAATGG + Intergenic
1115993180 14:39170407-39170429 AATGCCGGGGTAGAGGGGACCGG - Intronic
1116677084 14:47919993-47920015 CCTGCCAGTGTTGAGGAGACTGG - Intergenic
1117246153 14:53888840-53888862 GAAGCCAGGGTGGAGAAAACAGG - Intergenic
1118301697 14:64622516-64622538 AAAGGCAGGGTTGGGGAGGCAGG + Intergenic
1119762692 14:77163121-77163143 AATGCCAGGGTTCAGGAGAGTGG - Intronic
1120463466 14:84826306-84826328 AAAGCTAGGGTTGGGGAGGTAGG - Intergenic
1121520617 14:94583788-94583810 AAAGCCAGGGACCAGGAGAGGGG + Intronic
1124931480 15:34124032-34124054 AAATCCAAGATTTAGGAGACTGG + Intergenic
1125475565 15:40045929-40045951 AAAGACAGGATTAAGGAGACAGG - Intergenic
1125904723 15:43380369-43380391 AAAGCCAGGATTTAGGTGCCTGG + Intronic
1127827672 15:62719218-62719240 AAAGCCAGGGGAAAGGAGAGAGG - Intronic
1129407147 15:75327438-75327460 AAAGCCAGGTGTGAGGAGTGGGG + Intergenic
1129734668 15:77952839-77952861 AAAGCCAGGTGTGAGGAGTGGGG - Intergenic
1129840922 15:78743152-78743174 AAAGCCAGGTGTGAGGAGTGGGG + Intergenic
1130057126 15:80536269-80536291 ATAGACAGGCTTGAGGAGCCAGG + Intronic
1130137764 15:81196216-81196238 AAAGCCTGGGCTTTGGAGACAGG + Intronic
1130329257 15:82908096-82908118 GAAGCCAGGGTAGAGGAAATTGG + Intronic
1130347048 15:83057180-83057202 AAAACCAAGGCTGAGGAAACAGG + Intronic
1130730900 15:86491204-86491226 TAAGCCAGGGTAGAAGAGAAGGG + Intronic
1131348540 15:91674573-91674595 AAAGCCAGGCTTTAGGAGTAGGG + Intergenic
1133942796 16:10324405-10324427 ATATCCAGGGTTGAGGATTCTGG + Intergenic
1134021267 16:10923184-10923206 AGAGCCAGGTTAGAGGAGAGAGG - Intronic
1134142370 16:11732077-11732099 AAAGACAGGGGTGTGGAGGCGGG + Intronic
1136576778 16:31129998-31130020 AAATCTAGGGTTGAGGAGGGGGG - Exonic
1137402574 16:48165276-48165298 AAAGCCAGGACTGAGGGGAAGGG + Intergenic
1138133721 16:54503355-54503377 AAAGACAGATTTGAGGAGACTGG - Intergenic
1140628981 16:76829281-76829303 AAAGCCAGGAGAGAGAAGACAGG - Intergenic
1141019112 16:80478452-80478474 AGAGCCAGGGCTTTGGAGACAGG + Intergenic
1142380795 16:89730815-89730837 AAGGTCAGGGTTGACAAGACTGG - Intronic
1144250038 17:13407185-13407207 AATGACAGGGTTGTGGACACTGG + Intergenic
1144563423 17:16340636-16340658 GAAGCAAGGTTTAAGGAGACAGG - Intronic
1145780599 17:27560502-27560524 AACGCAAGGGTAGAGGAGAGCGG - Intronic
1145808291 17:27750133-27750155 AAATCAAGGGGTGAGGAGAAAGG - Intergenic
1145950382 17:28812474-28812496 AGAGCCAGGGTGGAGGTGAGGGG - Intronic
1146272167 17:31491640-31491662 CAAGCCAGGGCTGGGGGGACAGG + Intronic
1146397012 17:32476304-32476326 ATAACTAGAGTTGAGGAGACAGG + Intronic
1146425776 17:32736919-32736941 AAAGGCAGGGGTAAGGACACTGG - Intronic
1146696157 17:34910306-34910328 GAGGCCAGTGTGGAGGAGACAGG - Intergenic
1146700592 17:34956310-34956332 AGAGCAAGGGGTGAGGAGAATGG - Intronic
1147717222 17:42516570-42516592 AAACCCAGGGCTCAAGAGACAGG - Intronic
1148035298 17:44655809-44655831 AAAGCCCGGGCTTAGGACACAGG + Intergenic
1148159515 17:45442008-45442030 GGAGCCAGGGCTCAGGAGACAGG - Intronic
1149587544 17:57802665-57802687 AAAGCCTGGGCTGAGGAGTCTGG - Intergenic
1150266245 17:63834126-63834148 AAAGCAAGGGCTGAGAAAACGGG + Intronic
1150390850 17:64789095-64789117 GGAGCCAGGGCTCAGGAGACAGG - Intergenic
1150848426 17:68682346-68682368 AAAGACATGGAAGAGGAGACTGG - Intergenic
1151039602 17:70843330-70843352 AAAGCCAGGGTGAAGCTGACAGG - Intergenic
1151624895 17:75270674-75270696 AAAGAGAGGGTTGGGGAGAGGGG - Intronic
1151897320 17:76989193-76989215 ATCGCCAGGGTTTAGGAAACTGG + Intergenic
1157726333 18:49966884-49966906 AAAGCCACAGTTGGGGAGATTGG + Intronic
1158684223 18:59598480-59598502 AATGCCAGGTTTGAGGAATCTGG + Intronic
1161111857 19:2475264-2475286 AAAGCCATTGTTGAGGGGAATGG - Intergenic
1161414800 19:4139949-4139971 GAAACCAGGGTGGAGGAGAGTGG + Intergenic
1162042173 19:7977646-7977668 ATAGATAGGGATGAGGAGACAGG + Intronic
1163114193 19:15179334-15179356 AGGGCCAGGGTTGGGGGGACAGG - Intronic
1163151465 19:15417638-15417660 GCAGCCAGGGTAGAGGGGACTGG + Intronic
1163643182 19:18473392-18473414 AAAGCCAGTGTTTGTGAGACAGG - Intronic
1163856452 19:19706228-19706250 AATGTCAGGTTGGAGGAGACAGG + Intergenic
1164200607 19:23015055-23015077 ATAGCTAGGCTTGAGGAAACTGG - Intergenic
1164676803 19:30106607-30106629 AAGCACAGTGTTGAGGAGACTGG + Intergenic
1164744390 19:30600455-30600477 AAGGCCAGAGCTAAGGAGACAGG + Intronic
1164935408 19:32206592-32206614 TAAGCCATGGTTTAGGAGGCAGG + Intergenic
1164954194 19:32367290-32367312 AAAGCCTGGGCAGAGGCGACTGG - Intronic
1165968400 19:39604402-39604424 AGAGCAAGGGTTCAGGAGCCAGG - Intronic
1166321763 19:42023130-42023152 AAATCCAGGGTCGGGGAGAAAGG + Intronic
1166416785 19:42601104-42601126 AAATCCAAGGTCAAGGAGACAGG + Intronic
1166543770 19:43622502-43622524 AAAGCCAGGAATGGGGAGAGGGG + Exonic
1167045416 19:47046307-47046329 AAAGCCAGGGTTGAGGAGACAGG + Intronic
1167146353 19:47682483-47682505 GAGGCCACGGTTCAGGAGACGGG - Intronic
1167305394 19:48705517-48705539 AAAGCCAGGATTGAAGAGGCAGG - Exonic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
924971526 2:132440-132462 AAAGCGAGCCTTGAGGAGAGTGG + Intergenic
925983936 2:9199900-9199922 GTAGCAAGGGTTGAGGCGACAGG + Intergenic
926962899 2:18378301-18378323 AAGGCCAAGGATGAGGAGTCAGG + Intergenic
927725276 2:25417360-25417382 AAAGCTAGCCTTGAGCAGACAGG - Intronic
928704287 2:33930780-33930802 AAAGGCAGGGTTGAGGGCAGTGG + Intergenic
928828815 2:35454247-35454269 ATAACCAGGGTTGAGGGGACAGG + Intergenic
931326099 2:61225536-61225558 AAAAACAGGGTGGAGGGGACAGG - Intronic
931637916 2:64357206-64357228 AAAAGCTGGGTAGAGGAGACTGG - Intergenic
932025339 2:68126588-68126610 AAAGCCACGGATTAGGAGAGAGG + Intronic
932365307 2:71148271-71148293 AAAGCCAGAATATAGGAGACTGG - Intronic
933730380 2:85451780-85451802 AAACCCAGAGTTCAGGGGACAGG - Intergenic
933799941 2:85952823-85952845 AAAGGCAGGAAGGAGGAGACAGG + Intergenic
935532145 2:104247600-104247622 AAAACTAGGATTCAGGAGACTGG - Intergenic
935653072 2:105398841-105398863 AGAGCCGGAGTTGGGGAGACTGG - Intronic
936284237 2:111168948-111168970 AAAGCCTGGTTTGGGGATACAGG + Intergenic
937230725 2:120396778-120396800 CAAGACAGGGGTGAGAAGACAGG - Intergenic
937402459 2:121596482-121596504 AAAGCCAAGGTTTTGGAGATAGG + Intronic
938340474 2:130532794-130532816 AAACCCAGGCTTGAGGAGGTGGG + Intergenic
938349356 2:130587925-130587947 AAACCCAGGCTTGAGGAGGTGGG - Intergenic
939808104 2:146799411-146799433 ACAGCCAGAGTTGAGGATAAGGG + Intergenic
941166220 2:162086008-162086030 AGAGCCAGGGTTTGGAAGACTGG + Intergenic
941358475 2:164521692-164521714 GAAGCCAAGGATGAGGAGAAAGG + Intronic
943736011 2:191355491-191355513 AAAGGCAAGGTTGAGGAAAGTGG + Intronic
944330206 2:198456916-198456938 TAAGCCAGGGTTTAGAAAACAGG + Intronic
945698121 2:213134634-213134656 AAAGCCAGGGAGTAGGAGATGGG - Intronic
946900673 2:224368554-224368576 AAAGCCATGGAAGAGGAGAAAGG + Intergenic
947961773 2:234245595-234245617 AAATAGAGGGTGGAGGAGACAGG - Intergenic
948090312 2:235288189-235288211 GGAGCAAGGGTTGAGGAGAAAGG - Intergenic
948313131 2:237004661-237004683 GAAGCCAGGAGAGAGGAGACTGG + Intergenic
948697847 2:239742340-239742362 AACACCAGGACTGAGGAGACTGG + Intergenic
1169053480 20:2600080-2600102 AAAGCCAGGGTAGGGGTGACTGG + Intronic
1169121963 20:3102144-3102166 AAATCCAAGGTTGAAGAGAAAGG + Intergenic
1170822360 20:19765406-19765428 AAACCCAGACTGGAGGAGACTGG + Intergenic
1172602876 20:36195803-36195825 GAAGCTAGGGGTGAGGACACAGG - Intronic
1172966388 20:38838501-38838523 AAAGCCTGGGGTGAGCAGCCTGG + Intronic
1173026376 20:39311040-39311062 CAGCCCAGGGCTGAGGAGACCGG - Intergenic
1173411360 20:42813215-42813237 AAAGCGAGGGTTCAGGATAATGG - Intronic
1174148693 20:48470388-48470410 AATGCAAGGGTTGGGGAGAATGG + Intergenic
1174273325 20:49385237-49385259 ATACCCAGGGATCAGGAGACAGG + Intronic
1175224361 20:57436282-57436304 CCAGCCAGAGTTGGGGAGACTGG - Intergenic
1176065909 20:63194683-63194705 GCAGCCACGGTTGAGGAGGCTGG - Intergenic
1178910190 21:36667849-36667871 AAAGCCAGGAGTGAGGAAATGGG - Intergenic
1179105654 21:38398013-38398035 AAACCAAGAGTGGAGGAGACAGG + Intronic
1179178217 21:39023668-39023690 CAAGCCAGGCTTGAGAAGATGGG - Intergenic
1179615560 21:42580982-42581004 GAAGCCAAGGGTGAGGAGGCAGG + Exonic
1179893912 21:44350959-44350981 AAAGCCAGCGCTTCGGAGACTGG - Intronic
1180048582 21:45321058-45321080 CAAGTCAGATTTGAGGAGACGGG + Intergenic
1181635621 22:24173051-24173073 AAAGGGAGGGTTGGGGAAACTGG - Intronic
1182748250 22:32622229-32622251 GAGGTCAGGGTTGGGGAGACAGG - Intronic
1183259560 22:36785646-36785668 AATGCCAGGGTTTAGGATAGGGG + Intergenic
1183942375 22:41302643-41302665 ACAGACAGAGTTGAGGAGAAAGG - Intronic
1184822162 22:46917554-46917576 AAAGAGCGGGTTGAGGAGGCGGG + Intronic
1184945334 22:47798531-47798553 AAAGCCAGGGCTGAGGTTTCCGG + Intergenic
1185273029 22:49937297-49937319 ATAGCCAGGGTTGAGGGGGACGG - Intergenic
950106387 3:10391671-10391693 ATAGCCAGGGCAGGGGAGACGGG + Intronic
950221034 3:11196251-11196273 AAAGCCCCGGCTGAGGAGCCGGG - Intronic
951580948 3:24161843-24161865 TAAGCCAGGATCGAGGAGATGGG - Intronic
951655956 3:25008740-25008762 TCAGGCAGGGTTGAGGAGATAGG - Intergenic
953982771 3:47420882-47420904 ACAGCCAGGGCTGAGGAGGCGGG + Intronic
954621795 3:52000665-52000687 AAAGCCAAGGTGGAGGAAAGTGG + Intergenic
955578637 3:60394534-60394556 AGAGCCATGGTTAAGGACACAGG + Intronic
956654494 3:71535875-71535897 CAAGCCAGGGTGGAGGGCACGGG - Intronic
961235287 3:125361151-125361173 AAAGCCAGGTAAGATGAGACAGG - Intronic
961503645 3:127355743-127355765 AAAGCCAGGGATGGGGAGGGTGG - Intergenic
963084712 3:141426269-141426291 TGAGCCAGGGTTTGGGAGACAGG - Intronic
964074385 3:152675689-152675711 GAAGCTAGGGTTGTGGAGCCAGG + Intergenic
964423706 3:156530959-156530981 AATGCCCTGGTTGAGGTGACAGG + Intronic
966933476 3:184690728-184690750 AGAGCCCGGGCAGAGGAGACTGG - Intergenic
968471612 4:785139-785161 AAAGCCAGCTCTGAGCAGACAGG - Exonic
969480663 4:7445330-7445352 AAAGCCGGGGGAGAGGAGCCAGG + Intronic
970049823 4:11901165-11901187 ATATCCAGGGATGAGGAGAAGGG - Intergenic
970384818 4:15545668-15545690 AAAGCCAGGAGTGAGGGGATGGG + Intronic
970698761 4:18709967-18709989 AAGCCCAGAGCTGAGGAGACAGG - Intergenic
970716822 4:18936265-18936287 AAAGGCAGGGCGGAGGGGACTGG + Intergenic
973888237 4:55344487-55344509 ACAGGAAGGGTTGAGGAGGCTGG - Intergenic
973968278 4:56185760-56185782 TAAGTCAGGGGTGGGGAGACAGG - Intronic
975803261 4:78085547-78085569 GAAGACAGGGTTGAGGACACAGG - Intronic
976081130 4:81356126-81356148 AAGGAAAGGGTGGAGGAGACAGG + Intergenic
981575691 4:146202736-146202758 AAACCCAGGATGGAGGAGACAGG - Intergenic
982115403 4:152094788-152094810 GAAGCCAGGGCTGAGGACACAGG - Intergenic
982429303 4:155304556-155304578 AAAGCCAGGGTGTGGGAGGCGGG + Intergenic
982658131 4:158174229-158174251 AAGGCCTGGGCTGAGGAGAGAGG - Intergenic
984107998 4:175574464-175574486 CAGGCCAGGGTAGAGGAGAAAGG - Intergenic
985345590 4:189001565-189001587 ATAGACAGGCTTGAGGAGGCGGG - Intergenic
985740492 5:1613088-1613110 AATGCCAGTGTTGGGGAGAATGG + Intergenic
986066017 5:4234915-4234937 AAGGCCAGGATTCAGGAAACAGG + Intergenic
986090794 5:4502633-4502655 AAAGACAGTGTTGAGAAAACTGG - Intergenic
986443096 5:7798323-7798345 AAAGCCAGGTTTGAGTATTCAGG + Intronic
986847500 5:11772749-11772771 AAAGCCACGGTGGGGGAGTCCGG + Intronic
987071955 5:14346104-14346126 TAAGCCAGGCTTGGAGAGACTGG + Intronic
987075968 5:14382219-14382241 AAAGCCAGGGTAGGGGCCACAGG - Intronic
987197275 5:15539351-15539373 AAAGCCCAGGTTGAGGATGCTGG + Intronic
987792609 5:22587305-22587327 AAGGCCAAGGTCGAGGTGACTGG - Intronic
988065103 5:26222433-26222455 AATGCAAGTGTTGAGGAGAATGG + Intergenic
990220060 5:53578363-53578385 AAAGCTAGGGTCAAGGACACTGG - Intronic
990524072 5:56607732-56607754 AAAGACAGGGCTGGGGCGACAGG + Intergenic
990547243 5:56835290-56835312 GAAGGCAGGGAAGAGGAGACAGG + Intronic
990547257 5:56835356-56835378 GAAGGCAGGGAAGAGGAGACAGG + Intronic
990547271 5:56835422-56835444 GAAGGCAGGGAAGAGGAGACAGG + Intronic
990547276 5:56835444-56835466 GAAGGCAGGGAAGAGGAGACAGG + Intronic
994534880 5:101017227-101017249 CAACCCAGGATTGAGAAGACTGG - Intergenic
995274746 5:110265405-110265427 AAAAACAGAGTTGAGGAGTCAGG - Intergenic
995600934 5:113795075-113795097 AAAGCCAAGGTTTAGGAGGGTGG + Intergenic
1001000519 5:168002128-168002150 AAAGCCATGGATGAGAAGAGAGG + Intronic
1001350491 5:170958400-170958422 GAAGCCAGGGGTGAGGTGAGAGG + Intronic
1001885044 5:175282244-175282266 AAAGCCAGAGATGAGGAATCAGG - Intergenic
1002427190 5:179183368-179183390 AAGGCCAGGGATGAGGGGCCAGG + Intronic
1003114912 6:3277279-3277301 AAGGCCAGGGTGGAGGAGAAGGG - Intronic
1003442031 6:6151788-6151810 AAACCTTGGGTTGGGGAGACCGG - Intronic
1004546477 6:16603249-16603271 AAAGCCAGGGGAAAGGAGAATGG - Intronic
1004569373 6:16830818-16830840 ACAGCCGAGGTTGAGGACACTGG - Intergenic
1006105638 6:31714539-31714561 AAGGCTGGGGTTGAAGAGACTGG + Intronic
1007225253 6:40309117-40309139 TAAGGCAGGGTTAAGGAGAGTGG - Intergenic
1008588272 6:52968745-52968767 AAAACCAGAGCTGAGGAGATGGG - Intergenic
1008914926 6:56776922-56776944 AAAGTCAGTTTTGAGGAGACAGG + Intronic
1009303158 6:62052769-62052791 AATGCCAGGGTTGATCTGACAGG + Intronic
1010657571 6:78529699-78529721 AAAGTGGGGGTTGAGGAGAGTGG - Intergenic
1011233106 6:85186280-85186302 AAAGCCCGGGTTTGGTAGACAGG + Intergenic
1011984134 6:93420305-93420327 AAAGACAGGGCGGAGGAGAAGGG - Intergenic
1012229601 6:96745394-96745416 AAGGCCAGGTTTGGGGAGATAGG + Intergenic
1012620067 6:101333088-101333110 AGAGCCAAGGATGATGAGACAGG - Intergenic
1012932316 6:105329995-105330017 ACAGCCAGGAATGAGGAGAGGGG + Intronic
1013427475 6:110026363-110026385 AAACCCAATGTTGATGAGACTGG + Intergenic
1015715059 6:136183858-136183880 AAAATCAAGGTTGAGGACACAGG + Intronic
1016319052 6:142822045-142822067 AAGACCAGGGTTGAGGTGCCAGG + Intronic
1016747370 6:147595412-147595434 AAAGACTGGGTTGAAGAGCCAGG - Intronic
1017009101 6:150050673-150050695 AATGCAAGGGTTGGGGAGAATGG + Intergenic
1017821356 6:158051158-158051180 CAGGCCAGGGCTGAGGAGCCTGG - Intronic
1018170240 6:161138732-161138754 GACGCCAGGCTTGGGGAGACAGG + Intronic
1018454481 6:163939794-163939816 AAAGCCACCCTTGAGGAGCCTGG - Intergenic
1019703789 7:2487953-2487975 AAAACAAGGGATGTGGAGACAGG + Intergenic
1022056773 7:26744550-26744572 AGAGCTAGAGTTGAGGAGAATGG + Intronic
1022420433 7:30215723-30215745 AAAGCACAGTTTGAGGAGACAGG + Intergenic
1023422667 7:39999479-39999501 AAAGCCAGGGATAAAGACACTGG + Exonic
1024752774 7:52487599-52487621 GAAGGCAGGGATGAGCAGACAGG - Intergenic
1026804858 7:73423539-73423561 AGAGCAAGGGTAGTGGAGACAGG + Intergenic
1027705788 7:81531824-81531846 AGAACCAGGGTTGAGGGGATGGG + Intergenic
1028679141 7:93505578-93505600 GGAGACAGGGTTGAGAAGACGGG - Intronic
1028741471 7:94280619-94280641 AAAGTTAGAGTTGAGGATACAGG + Intergenic
1029065653 7:97845333-97845355 CAAGCCAGGGTTTAGTAGAGTGG + Intergenic
1029834595 7:103296248-103296270 AAGGCCTGGGTTGGGCAGACAGG + Intergenic
1030143656 7:106331104-106331126 CAAGCAAGTGTGGAGGAGACTGG + Intergenic
1030822730 7:114115463-114115485 AGAGCCAGGGGAAAGGAGACAGG - Intronic
1030878863 7:114851163-114851185 AAAACCAGGCCTGAGGAGAGAGG - Intergenic
1030917958 7:115340410-115340432 AAAGACATACTTGAGGAGACTGG + Intergenic
1031491341 7:122393388-122393410 AAGGTCAGGGTTGAAGAGGCAGG + Intronic
1032548477 7:132762798-132762820 AAAGCAAAGGTAGAAGAGACAGG - Intergenic
1033648566 7:143323089-143323111 AGAGCCAGGGTGGAGGAGGGTGG - Intronic
1033658187 7:143387261-143387283 GAAGCCAGGGCTGAGGGGAGAGG + Intronic
1034243997 7:149630778-149630800 AAAGGCAGGGTAGAAGACACTGG - Intergenic
1034350798 7:150413609-150413631 AAAGCCAGAGATGAGAAGATGGG + Intergenic
1035078629 7:156198241-156198263 AAAGCGACGGTGGAGGACACTGG + Intergenic
1036756991 8:11477329-11477351 AAGGCCACGGCTGAGGAGAAGGG + Intergenic
1038817370 8:30918565-30918587 CAATTCAGGGTTGAGGAGGCAGG + Intergenic
1039475758 8:37838690-37838712 AAAACCAGAGATGAGGAGAAAGG - Intronic
1039948353 8:42149233-42149255 AAGTCCAGGGTTCAGGAGAGTGG - Intergenic
1043239875 8:77919074-77919096 AAAATCAGGGGAGAGGAGACTGG + Intergenic
1044714546 8:95088444-95088466 AAAGGCAGGGTAGAAGAGAGCGG - Intronic
1044780128 8:95735191-95735213 ACAGTCAGGGATGAGGAGAGGGG - Intergenic
1045270823 8:100659788-100659810 AAAGCCAGAGTTGAAAAGACTGG - Intronic
1047940285 8:129822625-129822647 AATGCCAGGGGTGGGGAGCCAGG + Intergenic
1047968239 8:130063418-130063440 AAAGCCAGGAGTGCGGAGAGAGG - Intronic
1048216113 8:132497053-132497075 AAAACCAGGGGCGAGGACACAGG - Intergenic
1048593532 8:135843622-135843644 GAAGCCAGGATTGAAGAGAACGG + Intergenic
1049157375 8:141075303-141075325 AAAGGCCGGGCTGAGGAGCCTGG + Intergenic
1049296823 8:141845204-141845226 ACAGCCGGGGGTGAGGAGCCCGG + Intergenic
1050902954 9:10967985-10968007 ATAGCCAGGGTGGGGGAGAGAGG - Intergenic
1051583726 9:18705224-18705246 AAAGTCAAGGTTAAGGAGCCAGG + Intronic
1053147644 9:35722753-35722775 AAAGCCAAGTTAGGGGAGACGGG + Intronic
1053481184 9:38417692-38417714 AAAGTCAGGGTTGGGGAAGCAGG + Intronic
1055205786 9:73728748-73728770 AAAGACAGGGTTGAGGAGGAGGG - Intergenic
1055287359 9:74743221-74743243 AGAGCCTGGGTTGAGGAGTCTGG + Intronic
1056099469 9:83287046-83287068 AAAGGCAGACTTGTGGAGACAGG - Intronic
1056559614 9:87718678-87718700 AAAGCCAAGGCTGAAGAGAGAGG - Intergenic
1056857059 9:90140623-90140645 AAAGCCAGGGCCCAGGAGGCAGG - Intergenic
1058520834 9:105812677-105812699 AAAGCCAGGGTGGAAGAGGGGGG - Intergenic
1059930557 9:119256094-119256116 AGAGCCTAGGTTGAGGATACAGG - Intronic
1060554437 9:124500973-124500995 AAAGGCAGGGTGGAGGAGGAAGG - Intronic
1061118395 9:128628645-128628667 AAAGCCAGGGCTGCTGGGACTGG + Intronic
1061598004 9:131645039-131645061 AAAGCCAGGGTGCAGGACCCAGG - Intronic
1062271555 9:135712181-135712203 GGAGCCAGGGCTGAGGTGACGGG - Intronic
1062526805 9:136981211-136981233 GAAACCAGGGTGGGGGAGACAGG + Intronic
1189487795 X:41446266-41446288 AAAGCCCTGTTTTAGGAGACTGG - Intergenic
1189681131 X:43517822-43517844 AGATCCAGGGTTGGGGAGAGAGG + Intergenic
1192210641 X:69125643-69125665 GAAGCCAAGGTTCAGGAAACAGG + Intergenic
1194481275 X:94427970-94427992 AAAGCCATGATTGAGTAGATGGG - Intergenic
1195211137 X:102652861-102652883 AAAGGCAAGGAGGAGGAGACTGG + Exonic
1195217292 X:102713812-102713834 AAAGGCAAGGAGGAGGAGACTGG + Exonic
1195413636 X:104596690-104596712 AGAGCCAGGGTTCAAGAGAAGGG - Intronic
1196239581 X:113326296-113326318 GTCGCCAGGGCTGAGGAGACAGG + Intergenic
1196858262 X:120003675-120003697 AAATGCAGTGTTGAGGAGAATGG - Intergenic
1196927318 X:120646345-120646367 AAATTCATGGTTGAGGAGAAAGG - Intergenic
1198629473 X:138618628-138618650 CAAGCCAAGGTAGAGGAGAGAGG - Intergenic