ID: 1167045419

View in Genome Browser
Species Human (GRCh38)
Location 19:47046319-47046341
Sequence GAGGAGACAGGAACAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1233
Summary {0: 1, 1: 0, 2: 4, 3: 129, 4: 1099}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167045411_1167045419 15 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045419 19:47046319-47046341 GAGGAGACAGGAACAGAGGCAGG 0: 1
1: 0
2: 4
3: 129
4: 1099

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167045419 Original CRISPR GAGGAGACAGGAACAGAGGC AGG Intronic