ID: 1167045420 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:47046320-47046342 |
Sequence | AGGAGACAGGAACAGAGGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1385 | |||
Summary | {0: 1, 1: 0, 2: 6, 3: 152, 4: 1226} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167045411_1167045420 | 16 | Left | 1167045411 | 19:47046281-47046303 | CCAAGGTCGGGGGATGGTCTGGG | 0: 1 1: 0 2: 1 3: 35 4: 461 |
||
Right | 1167045420 | 19:47046320-47046342 | AGGAGACAGGAACAGAGGCAGGG | 0: 1 1: 0 2: 6 3: 152 4: 1226 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167045420 | Original CRISPR | AGGAGACAGGAACAGAGGCA GGG | Intronic | ||