ID: 1167045423

View in Genome Browser
Species Human (GRCh38)
Location 19:47046332-47046354
Sequence CAGAGGCAGGGCCGTGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167045417_1167045423 -2 Left 1167045417 19:47046311-47046333 CCAGGGTTGAGGAGACAGGAACA 0: 1
1: 0
2: 2
3: 25
4: 262
Right 1167045423 19:47046332-47046354 CAGAGGCAGGGCCGTGCCAGGGG 0: 1
1: 0
2: 7
3: 58
4: 375
1167045411_1167045423 28 Left 1167045411 19:47046281-47046303 CCAAGGTCGGGGGATGGTCTGGG 0: 1
1: 0
2: 1
3: 35
4: 461
Right 1167045423 19:47046332-47046354 CAGAGGCAGGGCCGTGCCAGGGG 0: 1
1: 0
2: 7
3: 58
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167045423 Original CRISPR CAGAGGCAGGGCCGTGCCAG GGG Intronic