ID: 1167046877

View in Genome Browser
Species Human (GRCh38)
Location 19:47054903-47054925
Sequence CAGAGCAAAGAGCAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167046874_1167046877 4 Left 1167046874 19:47054876-47054898 CCTGAGGTCGTAGGTGGATCTTT 0: 290
1: 334
2: 165
3: 83
4: 108
Right 1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167046877 Original CRISPR CAGAGCAAAGAGCAGGAGGA TGG Intergenic
No off target data available for this crispr