ID: 1167052839

View in Genome Browser
Species Human (GRCh38)
Location 19:47090150-47090172
Sequence GCAGGGGCGTGGCATGCGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167052830_1167052839 1 Left 1167052830 19:47090126-47090148 CCATCTTGGAGTATGCCTTCTTG 0: 1
1: 0
2: 3
3: 20
4: 206
Right 1167052839 19:47090150-47090172 GCAGGGGCGTGGCATGCGATGGG 0: 1
1: 0
2: 2
3: 8
4: 101
1167052828_1167052839 17 Left 1167052828 19:47090110-47090132 CCATAACTCTTGCTGTCCATCTT 0: 1
1: 0
2: 3
3: 18
4: 201
Right 1167052839 19:47090150-47090172 GCAGGGGCGTGGCATGCGATGGG 0: 1
1: 0
2: 2
3: 8
4: 101
1167052827_1167052839 28 Left 1167052827 19:47090099-47090121 CCTCGTACATGCCATAACTCTTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1167052839 19:47090150-47090172 GCAGGGGCGTGGCATGCGATGGG 0: 1
1: 0
2: 2
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167052839 Original CRISPR GCAGGGGCGTGGCATGCGAT GGG Exonic
901196511 1:7443299-7443321 GCTGGGGCTGAGCATGCGATGGG - Intronic
901567290 1:10128545-10128567 CCAGGGGTGTGGCATGGCATTGG + Intronic
905446502 1:38031204-38031226 GCAAGGAGGTGGCATGGGATGGG + Intergenic
912201388 1:107461871-107461893 GCAGAGGCGTGCCATGATATAGG + Intronic
919806092 1:201381822-201381844 GCAGGGGCCTGGCATGAGGGAGG + Exonic
920526130 1:206667920-206667942 GCAGGGCAGTGGCATGAGAATGG + Intronic
922273802 1:224058003-224058025 GCAGGGGTGTGGCAGGTGCTTGG + Intergenic
923573889 1:235140675-235140697 GCAGGCGCACGGCATGGGATTGG + Intronic
1062856268 10:780959-780981 GCAGGGCCCTGGCCTGCAATGGG + Intergenic
1069718276 10:70534431-70534453 GCAGGGGCTTGGCCTGCGTGGGG - Exonic
1069865883 10:71502586-71502608 GCAGGGGCCTGGTATGCTTTCGG + Intronic
1074389388 10:113044474-113044496 GCTGGGACGTGGCATGTGTTGGG + Intronic
1074815187 10:117137365-117137387 GCAGGGCCGTAGCCCGCGATCGG + Intronic
1076650182 10:131982029-131982051 GCAGGGGCGTGGGGTGCGTGTGG + Intergenic
1076814634 10:132908732-132908754 GCAGAGGCGTGGCCTGTGAAGGG + Intronic
1077815669 11:5683284-5683306 GCAGGTGCGTGGCATGGCACAGG + Intronic
1079867672 11:25756470-25756492 GCAGGTGCGTGGCGTGGGACTGG + Intergenic
1080637919 11:34139626-34139648 GCAGGGGCCTGGCAAGCGGGTGG - Intronic
1088609880 11:111566766-111566788 GGAGGTGTGTGGCATGCGGTAGG - Intergenic
1091793814 12:3286162-3286184 GCAGGGACGTGGCATAGGATGGG + Exonic
1117223633 14:53633034-53633056 GCAAGGGCTTGGTATGTGATTGG + Intergenic
1121304684 14:92898732-92898754 GCAGGGGCGGGGCATGAATTGGG - Intergenic
1122853696 14:104549690-104549712 GCAGGGTTGTGGCATGTGTTTGG - Intronic
1123042799 14:105497235-105497257 GCAGGGGCGGGGCGTGAGCTAGG + Intronic
1130795754 15:87207623-87207645 GCAGGGGCCTGGCATCGGCTTGG + Intergenic
1133628867 16:7599694-7599716 GGAGGGCAGTGGCATGCTATTGG + Intronic
1134593891 16:15479893-15479915 GCAGTGGCGTGGCATGATAATGG - Intronic
1135789161 16:25377537-25377559 GCAGAGGCTTGGGATGCGCTAGG + Intergenic
1135967942 16:27051461-27051483 CCAGGGGTCTGGCATGGGATAGG + Intergenic
1139512559 16:67435863-67435885 GCAAGGGCGTGGCAGGGGAGTGG + Intronic
1140286030 16:73603827-73603849 GCAGTGGCGTGGCATGATATCGG + Intergenic
1142127372 16:88416888-88416910 GCAGGGGCCTGTCCTGCGGTCGG + Intergenic
1142484317 17:236853-236875 CCACGGGCGGGGCATGCGCTGGG + Intronic
1143028767 17:3955739-3955761 GCAGGGGCGAGGCCTGGGGTTGG + Intronic
1143331441 17:6139089-6139111 GCAGGTGCGTAGCAGGTGATAGG - Intergenic
1145754815 17:27382649-27382671 CCAGGGGCTTCGCATGTGATTGG + Intergenic
1147952910 17:44116982-44117004 GCAGGTGCGTGGCATTGGGTGGG - Intronic
1148122768 17:45222296-45222318 GCAGGGGCGCGGCAGGGGCTGGG + Intronic
1148144570 17:45354840-45354862 GCAGTGCCGTGGCATGCAGTAGG - Intergenic
1148281682 17:46353122-46353144 GCAGGTGCGTGGCTAGAGATTGG - Intronic
1148303907 17:46571061-46571083 GCAGGTGCGTGGCTAGAGATTGG - Intronic
1152124362 17:78437590-78437612 GCCAGGCCGTGGCATGGGATGGG + Intronic
1152697859 17:81805438-81805460 GGAAGGGGGTGGCATGCGGTGGG + Intronic
1152739387 17:82012366-82012388 GGAGGGGCCTGGCAGGCGCTGGG + Intronic
1153706456 18:7750606-7750628 GTAGGGGCATGGCATGAGAGAGG - Intronic
1157738855 18:50074409-50074431 GCAGGGAAGTGACATCCGATGGG - Intronic
1161250426 19:3276848-3276870 GCAGGGGCGTGGCTTGTGATGGG + Intronic
1162672288 19:12267093-12267115 GCAGTGGCGTGGCATGATCTCGG + Intronic
1163700883 19:18785937-18785959 GCGGGGGCGGGGCCTGCGGTGGG - Intronic
1163847040 19:19643652-19643674 GCGGGGGCGTGGCCTCCGCTGGG - Exonic
1164686889 19:30172555-30172577 GCAGGTGGGGGGCATGCGGTAGG + Intergenic
1166097625 19:40550986-40551008 GGATGGGCGTGGGATGCCATGGG - Intronic
1167052839 19:47090150-47090172 GCAGGGGCGTGGCATGCGATGGG + Exonic
1167739668 19:51316922-51316944 GGAGGGGCGGGGCATGAGACTGG - Intronic
929252938 2:39779315-39779337 GCAGGGGCGTGTGATGCCAAAGG + Intergenic
929555813 2:42925031-42925053 GCAGGGGAATGGCAGGCGAAGGG - Intergenic
931828546 2:66026645-66026667 TAAGGGGCGTGGCATGCATTAGG - Intergenic
938081428 2:128372331-128372353 GCAGGGAGGTGGCAAGTGATGGG - Intergenic
938409060 2:131048825-131048847 GCAGGGGTGTGGCTTGAGGTGGG - Exonic
938728882 2:134130392-134130414 GCAGGCGCGGGGCGTGGGATTGG + Intronic
940259574 2:151766015-151766037 GCAGGGGCGTGGAGAGCGATGGG - Intergenic
948790696 2:240375187-240375209 GCCTGGGCGTGCCATGCGACTGG - Intergenic
1172070457 20:32252846-32252868 GCAGTGGCGTGGCATGATCTTGG + Intergenic
1174037060 20:47674865-47674887 GCAGGGCCGTTGCCTGGGATGGG + Intronic
1180879605 22:19194592-19194614 GCAGGTGCCTGGCATCCGGTGGG - Intronic
949388655 3:3535055-3535077 GCAGGGGAGTGGCATGGTTTAGG + Intergenic
950601298 3:14037587-14037609 GCAGGCGCATGGCATGGGACTGG + Intronic
954103423 3:48395884-48395906 GCAGGGGCGTGGGAGCAGATGGG - Intronic
954701001 3:52450937-52450959 GCAGGGGGGTGAGATGAGATCGG - Intergenic
969411807 4:7033467-7033489 GCAGTGGGGTGGCATGAGGTGGG + Intergenic
970183369 4:13422736-13422758 ACAGGGGCCTGTCATGGGATGGG + Intronic
975733503 4:77359668-77359690 CCAGGGGCCTGGCAGGCGTTAGG - Intronic
977098314 4:92774219-92774241 ACAGGGGTGAGGCATGGGATAGG + Intronic
978466323 4:109012854-109012876 GCAGGCGCGTGGCATGGAAATGG + Intronic
978871932 4:113589177-113589199 GCAGAGGAGTGGCATGCTCTTGG + Intronic
979172704 4:117622268-117622290 GCATGGGCTTAGCATGGGATTGG - Intergenic
984203462 4:176756582-176756604 GAACGGGCATGGCATGTGATGGG + Intronic
985719753 5:1482683-1482705 GCAGGGGGGTGGGGTGTGATGGG + Intronic
986432175 5:7692025-7692047 GGAGGGGCCTGGGAGGCGATTGG - Intronic
987990204 5:25200066-25200088 GCAGGGGGGTGGCATTCGTCGGG + Intergenic
988500216 5:31777498-31777520 GCAGGTGCGTGGCATGGGACTGG + Intronic
992833236 5:80615658-80615680 GCAGGGGCGTGGGATGGGATTGG - Intergenic
1001017408 5:168153891-168153913 GCAGGGGCATGGCATGAGTTGGG + Intronic
1003966376 6:11256224-11256246 GCAGGTGCTTGGCATGGGAAAGG - Intronic
1004771388 6:18786195-18786217 GGAGGGGAGTGGGATGGGATGGG - Intergenic
1005751236 6:28885112-28885134 GCAGGTGCGTGGCACGGGACTGG - Intergenic
1007435246 6:41806003-41806025 ACAGGGCCGAGGCATGCGAGCGG - Exonic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1014100469 6:117506110-117506132 GCAGGTGCCTGGCATACAATAGG - Intronic
1014788543 6:125644836-125644858 GCAGGCGCATGGCATGGGACTGG + Intergenic
1016557125 6:145351434-145351456 GCAGGGGCACGGCATGGGAAGGG - Intergenic
1018697736 6:166403801-166403823 GAAGGGGGCTGGCAGGCGATGGG + Intergenic
1022530060 7:31061420-31061442 CCAGGGGCGTGGCAAGCCCTGGG + Intronic
1025106463 7:56175182-56175204 GCGGGGGCGTGGCGTCCGGTGGG + Intergenic
1035882568 8:3257992-3258014 GCAGGGGCACGGCAGGAGATTGG + Intronic
1037590743 8:20310107-20310129 GCAAAGGTGTGGCATGTGATAGG - Intergenic
1037973364 8:23191088-23191110 AGAGGGGATTGGCATGCGATCGG - Exonic
1041996774 8:64071174-64071196 GGAGGGGCGAGGCATGGGAGAGG + Intergenic
1042916334 8:73878917-73878939 GCGGGGGCGGGGTCTGCGATGGG + Intergenic
1045017969 8:98015319-98015341 GCAGTGGAGTGGCATGATATGGG - Intronic
1046080225 8:109362427-109362449 GCAGGGGCGGGGCAGGCCACGGG + Intergenic
1046908163 8:119596806-119596828 TAAGGGGCGTTGCATGCTATGGG + Intronic
1048985086 8:139730846-139730868 GAAGGGGCGTGGCATGGGGTGGG + Exonic
1049219541 8:141422578-141422600 GCAGGGGGCTGGCGTGTGATAGG + Intronic
1049684474 8:143933859-143933881 GCAGGGGCGGGGCATGTGGTGGG - Intronic
1051928984 9:22363445-22363467 GCAGGCATGTGGCATGGGATTGG - Intergenic
1055505420 9:76943286-76943308 ACAGGGGTGTGGCTTGAGATTGG + Intergenic
1061811304 9:133163983-133164005 GCAGGGGCGGGGCCTGCGGTAGG - Intergenic
1062234254 9:135500545-135500567 GCGGGGGCGGGGCACGCGAGGGG - Intronic
1194340382 X:92699464-92699486 GCAGGTGCATGGCATGGGAATGG - Intergenic
1200130619 X:153842423-153842445 GCAGTGGCGTGGCATGATCTCGG + Intergenic
1200648751 Y:5816216-5816238 GCAGGTGCATGGCATGGGAATGG - Intergenic