ID: 1167053833

View in Genome Browser
Species Human (GRCh38)
Location 19:47096359-47096381
Sequence GGGAAGGCACCTCCCTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167053833_1167053842 9 Left 1167053833 19:47096359-47096381 CCTGACAAGGGAGGTGCCTTCCC No data
Right 1167053842 19:47096391-47096413 CGGCCCACAGAAACCAGGCGTGG No data
1167053833_1167053841 4 Left 1167053833 19:47096359-47096381 CCTGACAAGGGAGGTGCCTTCCC No data
Right 1167053841 19:47096386-47096408 GGGTGCGGCCCACAGAAACCAGG No data
1167053833_1167053846 26 Left 1167053833 19:47096359-47096381 CCTGACAAGGGAGGTGCCTTCCC No data
Right 1167053846 19:47096408-47096430 GCGTGGAGCAAAGTCCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167053833 Original CRISPR GGGAAGGCACCTCCCTTGTC AGG (reversed) Intronic