ID: 1167054427

View in Genome Browser
Species Human (GRCh38)
Location 19:47100421-47100443
Sequence TAGGCACGTTACCATGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167054427_1167054436 29 Left 1167054427 19:47100421-47100443 CCATTTCCATGGTAACGTGCCTA 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1167054436 19:47100473-47100495 AAACTGGCAAAGAGAAGTCCAGG 0: 1
1: 0
2: 2
3: 32
4: 271
1167054427_1167054433 13 Left 1167054427 19:47100421-47100443 CCATTTCCATGGTAACGTGCCTA 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1167054433 19:47100457-47100479 ACCCAAGTGAGACACAAAACTGG 0: 1
1: 0
2: 0
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167054427 Original CRISPR TAGGCACGTTACCATGGAAA TGG (reversed) Intronic
900045806 1:505134-505156 TAGGCACCTCAGCATGGAGAGGG - Intergenic
901910419 1:12452979-12453001 TAGGTACCTTTCCATGGCAAAGG + Intronic
902260107 1:15218775-15218797 CTGGGTCGTTACCATGGAAAGGG - Intronic
903835613 1:26201498-26201520 TGCGCTCGTTAGCATGGAAAAGG + Exonic
906055063 1:42909477-42909499 GAGGGATATTACCATGGAAAAGG - Intergenic
908797064 1:67840809-67840831 TAGGCACGTTATTATGGGATAGG - Intergenic
914989534 1:152486396-152486418 AAGGCACTTTATCTTGGAAATGG + Intergenic
918152366 1:181808748-181808770 TAGGCAAGTTTCTAAGGAAAGGG + Intergenic
919470327 1:197970551-197970573 TAGCCACCTAAACATGGAAAGGG - Intergenic
921073880 1:211684438-211684460 TTGGGTCATTACCATGGAAAGGG + Intergenic
921337004 1:214098291-214098313 TAAGCAAATTAACATGGAAATGG + Intergenic
1062936057 10:1390897-1390919 AAGGCACGTTGTCTTGGAAATGG - Intronic
1063521296 10:6743640-6743662 AAGGCACTTTATCTTGGAAATGG + Intergenic
1064303124 10:14140589-14140611 CAGGCATGATACCAAGGAAATGG - Intronic
1065941178 10:30565236-30565258 AAGGCACTTTGCCTTGGAAAAGG - Intergenic
1069511220 10:69043905-69043927 GAGCCACGTTATAATGGAAAAGG + Intergenic
1073434735 10:103509490-103509512 TATGCACCTAACCATAGAAAAGG + Intronic
1074072164 10:110083199-110083221 TAGGAAAGTCACCATGGAAGGGG + Intronic
1074909574 10:117895512-117895534 TAGGGAGGATAGCATGGAAATGG - Intergenic
1078800678 11:14642035-14642057 TTGGCACGTGATCATGGAAACGG - Intronic
1079333294 11:19550871-19550893 TTGGGACATTGCCATGGAAAGGG - Intronic
1083870871 11:65487794-65487816 AAGGGAGGTCACCATGGAAACGG - Intergenic
1090333625 11:125948796-125948818 TATGCACGTTTTCCTGGAAAAGG - Intergenic
1090457410 11:126861977-126861999 TAGGCACCTGGGCATGGAAAAGG + Intronic
1102883756 12:116506476-116506498 TTGGGTCGTTGCCATGGAAAGGG - Intergenic
1104561155 12:129845985-129846007 TTGGGTCGTTGCCATGGAAAGGG + Intronic
1110687114 13:78388426-78388448 TAGGCAGGACACCAGGGAAAGGG - Intergenic
1111255442 13:85661740-85661762 TAGGGACTACACCATGGAAAGGG - Intergenic
1111430729 13:88145699-88145721 TTGGCTCATTGCCATGGAAAGGG + Intergenic
1112224610 13:97526242-97526264 CAGGCATGTTTTCATGGAAACGG - Intergenic
1115079260 14:29430833-29430855 TAGGCACCTGCCCTTGGAAAAGG - Intergenic
1115406957 14:33027837-33027859 TAGGCTGGATATCATGGAAATGG + Intronic
1122897460 14:104767378-104767400 TAGGCACTTTGTCTTGGAAATGG + Intronic
1124205562 15:27716079-27716101 GAGACATGTTACCATGGAGATGG - Intergenic
1127013905 15:54661191-54661213 TAGACACTTTCCCATGGGAATGG - Intergenic
1128146167 15:65333554-65333576 TAGGCACCTTAACATGGAAGAGG + Intronic
1130619326 15:85445272-85445294 TTGGCACCTTACCACTGAAAGGG + Intronic
1132662201 16:1066514-1066536 TCTGCACGTTTCCCTGGAAAAGG + Intergenic
1133810090 16:9154944-9154966 CAGGCACGTTTCCCTGGAGAGGG + Intergenic
1136402844 16:30027980-30028002 CAGGGACGGTACCAGGGAAAAGG + Intronic
1136689365 16:32017863-32017885 TTGGGTCGTTGCCATGGAAAGGG - Intergenic
1136789957 16:32961405-32961427 TTGGGTCGTTGCCATGGAAAGGG - Intergenic
1136879855 16:33892531-33892553 TTGGGTCGTTGCCATGGAAAGGG + Intergenic
1138083378 16:54112981-54113003 GAGGCACGTTAACATGCCAAAGG - Exonic
1138543244 16:57701206-57701228 AAGGCACTTTGCCTTGGAAACGG + Intronic
1142448115 16:90155915-90155937 TAGGCACCTCAGCATGGAGAGGG + Intergenic
1203092160 16_KI270728v1_random:1222868-1222890 TTGGGTCGTTGCCATGGAAAGGG - Intergenic
1147152211 17:38524008-38524030 TTGGGTCGTTGCCATGGAAAGGG - Intergenic
1148175566 17:45561350-45561372 TTGGCATGTTAACATGGAATAGG + Intergenic
1148295808 17:46501650-46501672 TTGGCATGTTAACATGGAATAGG - Intergenic
1149270752 17:54974933-54974955 TAGGGTCATTGCCATGGAAAGGG + Intronic
1150165508 17:62937692-62937714 TAGGGACGTTGCCAAGGAATTGG - Intergenic
1150785471 17:68159743-68159765 TTGGCATGTTAGCATGGAATAGG + Intergenic
1152134537 17:78496050-78496072 CAGACATGTTAGCATGGAAATGG + Intronic
1155455546 18:26008287-26008309 TGGGCAGGTTTCCATGGCAAGGG + Intergenic
1155551450 18:26970068-26970090 TAGGCACCCAACCATGGTAATGG - Intronic
1155680870 18:28483856-28483878 TTGGCATGCTGCCATGGAAATGG - Intergenic
1159983828 18:74819147-74819169 TAGGGAGTTTACTATGGAAAAGG + Intronic
1160062856 18:75548596-75548618 TTGGGTCGTTGCCATGGAAAGGG - Intergenic
1160649089 19:211916-211938 TAGGCACCTCAGCATGGAGAGGG - Intergenic
1164699229 19:30271123-30271145 TAGGAACTTTACCATGCAATAGG + Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1167054427 19:47100421-47100443 TAGGCACGTTACCATGGAAATGG - Intronic
928614985 2:33028845-33028867 AAGGCATGTTAACAAGGAAAAGG + Intronic
931819631 2:65938314-65938336 TAGCCACATTGCCAGGGAAAAGG + Intergenic
935136665 2:100310200-100310222 TTGGCAGGGTCCCATGGAAAAGG + Intronic
942441670 2:176043254-176043276 TAGGCAATTTACCAAAGAAAGGG - Intergenic
946996769 2:225401256-225401278 TAGTTACATTACCATGGAAATGG + Intronic
947617234 2:231566082-231566104 TTGGCTTGTTGCCATGGAAAGGG + Intergenic
1169559831 20:6787824-6787846 GAGTCGCATTACCATGGAAAAGG - Intergenic
1172890447 20:38260486-38260508 TTGGCGCGTTACCATGGTGACGG + Exonic
1173485188 20:43435952-43435974 TGGGCACTTCACCAAGGAAAAGG - Intergenic
1173573959 20:44098005-44098027 AAGGCACTTTATCTTGGAAATGG - Intergenic
1174707379 20:52670333-52670355 TTGGGTCGTTGCCATGGAAAGGG - Intergenic
1174970314 20:55267632-55267654 TGGGGTCGTTGCCATGGAAAGGG + Intergenic
1177859607 21:26437553-26437575 GAGGCAGGAAACCATGGAAAGGG - Intergenic
1183612754 22:38921677-38921699 GAGGCACTTTGCCTTGGAAATGG - Intergenic
950726148 3:14918347-14918369 TAGGCTCTTTACCATGGGGAAGG + Intronic
951754247 3:26072256-26072278 TAGGCAAGTAATCATGGGAAAGG + Intergenic
952283589 3:31946817-31946839 TAGAAAAGTTACCATGGAGATGG + Intronic
964092932 3:152897195-152897217 TGAGCACTTCACCATGGAAAGGG + Intergenic
964092961 3:152897603-152897625 TGAGCACTTCACCATGGAAAGGG + Intergenic
964137401 3:153360144-153360166 TAAGCACTTTACCATGTAACAGG + Intergenic
972131784 4:35845806-35845828 TATGCTCGTTACCGTGGTAATGG - Intergenic
976143333 4:82016058-82016080 TAGGCACTTCACCAAAGAAATGG + Intronic
977147750 4:93466577-93466599 TTGGGTCATTACCATGGAAAGGG + Intronic
977495611 4:97771571-97771593 TAGGCACGTGAGCATGTAGAAGG + Intronic
992777323 5:80099894-80099916 TATGCACAGTAGCATGGAAAGGG - Intergenic
996700326 5:126444331-126444353 TAGGCAAGTTACCTTAGAGAGGG - Intronic
997222632 5:132181800-132181822 TTGGGTCATTACCATGGAAAGGG + Intergenic
999001558 5:147929321-147929343 TAGTGACTTTACCATGAAAAGGG + Intergenic
1005845392 6:29772876-29772898 GAGGCAGGTTACCCTGGGAAAGG - Intergenic
1006369260 6:33633965-33633987 TAGGCAAGTTTGCATGGAGAGGG - Intronic
1015372040 6:132465195-132465217 TTGGGATGTGACCATGGAAATGG - Intronic
1017589942 6:155968143-155968165 TGGGCACGATACTAAGGAAAAGG - Intergenic
1018105890 6:160485926-160485948 TAGGAGTGCTACCATGGAAATGG - Intergenic
1019615154 7:1956098-1956120 AAGGCACTTTATCTTGGAAATGG + Intronic
1022759956 7:33337903-33337925 TTGGAACATTACTATGGAAAGGG - Intronic
1025829944 7:65039526-65039548 TAGGCAAGTTACTTTGAAAAAGG + Intergenic
1028297414 7:89151770-89151792 TAGGCTCTTTAACATGGCAATGG + Intronic
1032436456 7:131904978-131905000 TTGGGTCGTTGCCATGGAAAGGG - Intergenic
1035087459 7:156273002-156273024 TAGTCACGTTACTCTGTAAAGGG - Intergenic
1036567350 8:9948871-9948893 TATGCACGTCACCATGTAAAGGG + Intergenic
1040534641 8:48297879-48297901 TAGGCAAGTTACCAGGAAAGAGG - Intergenic
1042568561 8:70137496-70137518 TATTCAAGTTTCCATGGAAATGG + Intronic
1042983224 8:74554037-74554059 TAGGCACTTTATTATGGATAAGG + Intergenic
1045700504 8:104861441-104861463 TAGGCATGTTACCAAGGCACTGG - Intronic
1047560813 8:125986740-125986762 AAGGCACTTTGCCTTGGAAATGG - Intergenic
1052270303 9:26621471-26621493 AAGACACGTTATCATGAAAATGG + Intergenic
1053970908 9:43730281-43730303 TAGGAAGATTACCTTGGAAACGG + Intergenic
1053972075 9:43750532-43750554 TAGGAAGATTACCTTGGAAACGG + Intergenic
1053999725 9:44229761-44229783 TAGGAAGATTACCTTGGAAACGG + Intergenic
1054047273 9:45048095-45048117 TAGGAAGATTTCCATGGAAACGG + Intergenic
1203575614 Un_KI270745v1:5694-5716 TAGGCACCTCAGCATGGAGAGGG + Intergenic
1186045682 X:5534135-5534157 TTGGGACATTGCCATGGAAAGGG - Intergenic
1186114305 X:6289078-6289100 GAGGCACGTTGTCTTGGAAATGG + Intergenic
1187274009 X:17802971-17802993 TGGCCTCGTTACCATGGAGAAGG + Intronic
1188112525 X:26208904-26208926 TGGGCTCTTTATCATGGAAATGG + Intergenic
1195267878 X:103201139-103201161 TTGGGTCGTTGCCATGGAAAGGG - Intergenic