ID: 1167055769

View in Genome Browser
Species Human (GRCh38)
Location 19:47111250-47111272
Sequence CTGCTCGAGCAGAAGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167055769_1167055778 -8 Left 1167055769 19:47111250-47111272 CCCAACTCCTTCTGCTCGAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1167055778 19:47111265-47111287 TCGAGCAGGGGAAGGAAACGGGG 0: 1
1: 0
2: 0
3: 17
4: 206
1167055769_1167055776 -10 Left 1167055769 19:47111250-47111272 CCCAACTCCTTCTGCTCGAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1167055776 19:47111263-47111285 GCTCGAGCAGGGGAAGGAAACGG 0: 1
1: 0
2: 1
3: 34
4: 394
1167055769_1167055782 19 Left 1167055769 19:47111250-47111272 CCCAACTCCTTCTGCTCGAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1167055782 19:47111292-47111314 AACCTCGCCCTGAAACGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 24
1167055769_1167055777 -9 Left 1167055769 19:47111250-47111272 CCCAACTCCTTCTGCTCGAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1167055777 19:47111264-47111286 CTCGAGCAGGGGAAGGAAACGGG 0: 1
1: 0
2: 0
3: 25
4: 272
1167055769_1167055783 20 Left 1167055769 19:47111250-47111272 CCCAACTCCTTCTGCTCGAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1167055783 19:47111293-47111315 ACCTCGCCCTGAAACGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167055769 Original CRISPR CTGCTCGAGCAGAAGGAGTT GGG (reversed) Intronic
900193027 1:1359419-1359441 TTGCTTGATTAGAAGGAGTTGGG - Intronic
902469433 1:16638282-16638304 CTACCCGAGCCAAAGGAGTTGGG + Intergenic
903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG + Intergenic
905440128 1:37990310-37990332 CTGCGCGAGCAGTTGGAGTGCGG + Exonic
917402954 1:174671809-174671831 CTGGTCTAGCAGAATGAGTTTGG + Intronic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
919930568 1:202218731-202218753 CTTCCCGGGCAGAATGAGTTGGG - Intronic
920560198 1:206933217-206933239 CTCCTCGAGGTGAAGGAGTCTGG + Intronic
920594547 1:207255741-207255763 CAGCTGGAGCTGAAGAAGTTTGG + Intergenic
921447792 1:215266749-215266771 CTTCTTCAGCAGAAGGACTTTGG + Intergenic
1063883443 10:10553812-10553834 CTGCTGGAGGAGAAAGAGCTTGG + Intergenic
1068538449 10:58267247-58267269 CCACTCGAGCAGAAGGGGCTCGG - Intronic
1069528549 10:69196586-69196608 CTGCTCGGGGATAAGGAGCTTGG + Intronic
1071745408 10:88413173-88413195 CTACTAGAGCAGAAGGATATGGG - Intronic
1072621730 10:97084202-97084224 CTTCTAGAGAAGCAGGAGTTGGG - Intronic
1075310484 10:121409770-121409792 CTGCTGTAGCAGAAAGAATTTGG - Intergenic
1076020954 10:127072694-127072716 CTGCACGAACAGAAGGGATTAGG - Intronic
1076877876 10:133225506-133225528 CTGCTCCAGCAGCAGGCCTTGGG - Exonic
1077508029 11:2941126-2941148 CTGCTCCAGCAGAAGGAACCTGG + Intergenic
1077573678 11:3360525-3360547 CTGCTCTGGCAGAAGGTCTTGGG + Exonic
1077957091 11:7031958-7031980 CTGCTGGAGTAGAGGGAGTGGGG - Intronic
1080682845 11:34492117-34492139 CGGCTCCAGAAGAAGGAGCTTGG - Intronic
1081622832 11:44629055-44629077 CTGAGGGAGGAGAAGGAGTTAGG - Intergenic
1087675599 11:101158100-101158122 CAGCTGGAGCTGAAGCAGTTGGG - Intergenic
1090718599 11:129452507-129452529 CTGCTCTGGCAGAAGGCGGTGGG - Intergenic
1092045321 12:5428445-5428467 CTGCTAGAGCTGATGGAGTCTGG - Intergenic
1096555477 12:52400990-52401012 CTGCCCGAGCAGCTGGAGATGGG - Intronic
1096566071 12:52480337-52480359 CAGCTGGAGCTGAAGCAGTTGGG - Intergenic
1097214596 12:57400638-57400660 CTGCAGGAGCAGAAGGTGTCTGG - Intronic
1099973334 12:89523392-89523414 CTGCTCGGGCAGCAGAAGTTTGG - Exonic
1104757358 12:131277474-131277496 CTGCAGGAGGAGGAGGAGTTGGG + Intergenic
1104775688 12:131389000-131389022 CTGCAGGAGGAGGAGGAGTTGGG - Intergenic
1111885833 13:94019066-94019088 CTGCTCTCTCAGAATGAGTTAGG + Intronic
1116206611 14:41875312-41875334 GTGCTGGAACAGCAGGAGTTTGG - Intronic
1117498555 14:56329870-56329892 CTGCCCTAGCAGAAGGGGTATGG + Intergenic
1119017247 14:71071561-71071583 ATGCTGGAGCAGAAGGAATAGGG - Intronic
1124593785 15:31077344-31077366 CACCTGGAGCAGAAGGAGGTGGG + Intronic
1124827586 15:33114060-33114082 CTGCTCCAAGAGAAGGTGTTGGG - Intronic
1131950172 15:97673299-97673321 TTTCTCAAGCAAAAGGAGTTTGG + Intergenic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1141810449 16:86372194-86372216 CAGCTGGTGCAGAAGGAGGTGGG - Intergenic
1145729060 17:27158708-27158730 CTACTGGAGCAGAAGGCATTCGG + Intergenic
1146059548 17:29597218-29597240 CTGCTCATGCTAAAGGAGTTTGG + Intronic
1148512420 17:48183143-48183165 CAGCTCTAGCAAAAGGAGTGGGG + Intronic
1149349715 17:55774368-55774390 CTGCTCTACCAGAATGAGTGTGG + Intronic
1150355901 17:64484410-64484432 CTGCTGGAGCAGACTGAGTGAGG + Intronic
1152075772 17:78158752-78158774 CTGCTCGGGGAGAAGGGGGTGGG + Intronic
1155686956 18:28565355-28565377 TTGCTGGACCAGAAGCAGTTTGG - Intergenic
1155791273 18:29973585-29973607 CTCCTCGAGGAGAAGGGGATTGG - Intergenic
1159319319 18:66826445-66826467 TTGCTCTAGCAGAAGGATTTTGG - Intergenic
1161238815 19:3210713-3210735 TGGCTCGAGCAGAGGGAGTGAGG + Intergenic
1163258172 19:16170358-16170380 CTTCTAAAGCAGATGGAGTTGGG + Intronic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1164390287 19:27813916-27813938 TTACTCGAGCAGAAGTAGATGGG + Intergenic
1164534538 19:29075472-29075494 CTGCTCTAGCAGAGGGAGGAGGG + Intergenic
1167055769 19:47111250-47111272 CTGCTCGAGCAGAAGGAGTTGGG - Intronic
1167586960 19:50380755-50380777 CAGCTGGAGCACAAGGAGATGGG + Intronic
925662527 2:6218047-6218069 CTGCGCTTGCAGAAGGCGTTTGG - Intergenic
932039289 2:68282054-68282076 CTGCTGGAGGTGACGGAGTTTGG + Intergenic
932624449 2:73286062-73286084 CTGCAAGAGCAGATGGATTTGGG - Intergenic
932648173 2:73527275-73527297 CTGGTCTTGTAGAAGGAGTTTGG + Intronic
933451297 2:82455550-82455572 ATGCTAGACCAGAACGAGTTGGG - Intergenic
935530667 2:104229336-104229358 CTGATGGAGGACAAGGAGTTTGG - Intergenic
936491979 2:112979728-112979750 CTGCTTGAGCACATGGAGATGGG - Intronic
937115858 2:119404524-119404546 CTGCTTTAGCTCAAGGAGTTTGG + Intergenic
937913931 2:127089739-127089761 CTGCTGGGGCAGAAGGTGCTGGG + Intronic
942319796 2:174726275-174726297 CTGCCCCAGCAGCAGGAGTGAGG - Intergenic
947931524 2:233968705-233968727 CCCGTCAAGCAGAAGGAGTTTGG - Intronic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
949036436 2:241817633-241817655 CTGCTGGAGGAGTAGGAGGTAGG + Intergenic
1171109247 20:22465242-22465264 CTGCCAGAGGAGAAGGAGGTGGG - Intergenic
1173258360 20:41411249-41411271 CTCCTCTCGCAGAAAGAGTTTGG - Intronic
1174140001 20:48406059-48406081 CTTCACCAGCAGGAGGAGTTGGG + Intergenic
1175199589 20:57268020-57268042 TTTCTGGAGCAGAAGTAGTTTGG + Intergenic
1175888960 20:62307656-62307678 CTGCTGGAGCAGAAGGGGCTGGG - Exonic
1181945677 22:26515605-26515627 CTCCTTGGGCAGAAGGAGTCTGG + Intergenic
949520046 3:4843153-4843175 CTGCTAAAGGAGAAGGAATTGGG - Intronic
950702454 3:14759748-14759770 CCCCTGGAGCAGGAGGAGTTGGG + Intronic
952338750 3:32427695-32427717 CTGATCTAGAAGCAGGAGTTTGG + Intronic
954300005 3:49695930-49695952 CTACCCGAGCCAAAGGAGTTGGG - Intronic
954392673 3:50275722-50275744 CTGCTGGAACACAAGGTGTTCGG + Exonic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
959507756 3:107174925-107174947 CAGCTGGAGCTGAAGCAGTTGGG + Intergenic
959860889 3:111213474-111213496 CCGCTCTAGCAGGAGGACTTTGG - Intronic
962847238 3:139283447-139283469 CTGCTGGTGAAGGAGGAGTTGGG + Intronic
964241500 3:154600454-154600476 TGGCTGGAGCAGAAGGGGTTGGG + Intergenic
968032564 3:195513214-195513236 CTGCTTGAGCAGCAGGTCTTTGG + Intergenic
969847818 4:9933412-9933434 CTGGGAGAGCAAAAGGAGTTGGG - Intronic
974728267 4:65825207-65825229 CTGCTCAAGATGAAAGAGTTGGG + Intergenic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976480217 4:85534443-85534465 CTGCTCCAGCAGAAGGAATGTGG + Intronic
979838728 4:125408618-125408640 CTGTTCGAGCAGAAGATGGTGGG + Exonic
980441639 4:132855128-132855150 CCTCTCAAGCAGATGGAGTTGGG + Intergenic
981796484 4:148600890-148600912 CTGCTCCAGCAGAGGCAGTAGGG + Intergenic
983677088 4:170308347-170308369 ATCCTCGAGCATGAGGAGTTTGG + Intergenic
985579706 5:690172-690194 TTGCTCGAGCAGTAGGAACTAGG + Intronic
985594552 5:782231-782253 TTGCTCGAGCAGTAGGAACTAGG + Intergenic
992511463 5:77440163-77440185 CCCTTCGAGGAGAAGGAGTTGGG - Intronic
993501104 5:88667758-88667780 CTGCTCGGGCAGCAGGCGTGGGG - Intergenic
997229565 5:132232662-132232684 ATGCTGGGGCAGAAGCAGTTTGG - Intronic
997418621 5:133748801-133748823 ATGCTTGAGTAGAAGGGGTTGGG - Intergenic
1002857851 6:1054355-1054377 CTGCTCAAGCAAAAGAAATTTGG + Intergenic
1005519339 6:26584939-26584961 CTGCTGGATTAGAAGGAGTTAGG + Intergenic
1005856007 6:29863889-29863911 CTCATAGAGCAGCAGGAGTTGGG - Intergenic
1006630443 6:35426783-35426805 CTGCTGGAGCAGGATCAGTTGGG - Exonic
1007077183 6:39075280-39075302 CTGCTAGAGCAGGAGGAGGGAGG + Intronic
1007131280 6:39476509-39476531 CTGCACCATCAGAAGGAGCTGGG + Intronic
1008177338 6:48285176-48285198 TTTCTCAAGCAGAAGGAATTTGG + Intergenic
1009912844 6:69954287-69954309 CTCCTGGAGTAGAAGGACTTGGG + Intronic
1012827820 6:104167691-104167713 CTGGTCTTGCAGAATGAGTTTGG - Intergenic
1016983353 6:149874110-149874132 CTGCTCTTGTAAAAGGAGTTTGG + Intergenic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1020002413 7:4763412-4763434 CAGCTGGAGCAGATGGCGTTTGG - Exonic
1020279071 7:6641197-6641219 CTGCTCGAGCTGGATGAGCTAGG + Intronic
1024279916 7:47710371-47710393 CTGCTGGTGCTGCAGGAGTTGGG - Intronic
1030309938 7:108058988-108059010 CTGCTCAAATATAAGGAGTTAGG + Intronic
1030375869 7:108752957-108752979 CAGCTCTAGCAGAAGGATCTAGG + Intergenic
1035060025 7:156062355-156062377 CTGCAGGAGCAGGGGGAGTTGGG - Intergenic
1042713703 8:71747782-71747804 CTGCCAGAGCAGAAAGATTTTGG + Intergenic
1045342364 8:101266316-101266338 CTGCTAGAGCAGAAGGTGTATGG + Intergenic
1045384846 8:101662334-101662356 CTGGGCGAGCAGAAGGAGACTGG - Intronic
1045990081 8:108296699-108296721 CTGATCAAGCAGAAGGAAATGGG - Intronic
1046907178 8:119586603-119586625 CTGCTTGACTTGAAGGAGTTGGG - Intronic
1048585920 8:135773771-135773793 CACCTCGATCAGAAGGACTTGGG + Intergenic
1056424708 9:86465016-86465038 TTTCTCAAGCAGAAGGAGTTTGG + Intergenic
1058707586 9:107650083-107650105 CTACTGGAGCAGAAGAAGTGGGG + Intergenic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1059756355 9:117297282-117297304 CCGCCCGGGCAGAAAGAGTTGGG + Intronic
1062552593 9:137096714-137096736 CTGCTCGACCAGATGGGGCTCGG - Intronic
1187404383 X:18989555-18989577 CTGCTCAAGCAGATGTAGGTAGG + Exonic
1189774107 X:44454956-44454978 AAGCTGGAGCAGAAGGAATTAGG - Intergenic
1192434556 X:71135080-71135102 CTGTGCCTGCAGAAGGAGTTGGG + Exonic
1194165062 X:90505818-90505840 TTCCTCAAGCAGAAGGAGTTTGG - Intergenic
1195063979 X:101222505-101222527 CTGCTAGAGAAGCAGCAGTTGGG - Intronic
1195901665 X:109804235-109804257 CTGATTTAGCAGAATGAGTTGGG - Intergenic
1196512803 X:116532259-116532281 CTGCTGGAGCTGAAGCAGCTAGG + Intergenic
1198294046 X:135267748-135267770 CTGGTCTTGCAGAATGAGTTTGG - Intronic
1199287827 X:146073607-146073629 ATGCACTAGCAGAAGGACTTGGG + Intergenic
1199458438 X:148055883-148055905 CTTCTCCAGAAGATGGAGTTAGG - Intergenic