ID: 1167056101

View in Genome Browser
Species Human (GRCh38)
Location 19:47112422-47112444
Sequence ACCTGTCGTCAGGGAGCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167056077_1167056101 27 Left 1167056077 19:47112372-47112394 CCTCCTCTTCCTCCCCCCGGGGA 0: 1
1: 0
2: 5
3: 62
4: 550
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056094_1167056101 -8 Left 1167056094 19:47112407-47112429 CCAACCGGGGGCCTGACCTGTCG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056082_1167056101 14 Left 1167056082 19:47112385-47112407 CCCCCGGGGACGCAGCCCCGGCC 0: 1
1: 0
2: 2
3: 34
4: 336
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056078_1167056101 24 Left 1167056078 19:47112375-47112397 CCTCTTCCTCCCCCCGGGGACGC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056091_1167056101 -2 Left 1167056091 19:47112401-47112423 CCCGGCCCAACCGGGGGCCTGAC 0: 1
1: 0
2: 2
3: 7
4: 180
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056079_1167056101 18 Left 1167056079 19:47112381-47112403 CCTCCCCCCGGGGACGCAGCCCC 0: 1
1: 0
2: 2
3: 35
4: 376
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056083_1167056101 13 Left 1167056083 19:47112386-47112408 CCCCGGGGACGCAGCCCCGGCCC 0: 1
1: 0
2: 5
3: 41
4: 516
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056093_1167056101 -7 Left 1167056093 19:47112406-47112428 CCCAACCGGGGGCCTGACCTGTC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056073_1167056101 30 Left 1167056073 19:47112369-47112391 CCTCCTCCTCTTCCTCCCCCCGG 0: 1
1: 5
2: 48
3: 488
4: 3650
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056090_1167056101 -1 Left 1167056090 19:47112400-47112422 CCCCGGCCCAACCGGGGGCCTGA 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056084_1167056101 12 Left 1167056084 19:47112387-47112409 CCCGGGGACGCAGCCCCGGCCCA 0: 1
1: 0
2: 0
3: 29
4: 311
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056081_1167056101 15 Left 1167056081 19:47112384-47112406 CCCCCCGGGGACGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 28
4: 291
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056092_1167056101 -3 Left 1167056092 19:47112402-47112424 CCGGCCCAACCGGGGGCCTGACC 0: 1
1: 0
2: 0
3: 8
4: 167
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167056085_1167056101 11 Left 1167056085 19:47112388-47112410 CCGGGGACGCAGCCCCGGCCCAA 0: 1
1: 0
2: 0
3: 21
4: 244
Right 1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167056101 Original CRISPR ACCTGTCGTCAGGGAGCGGG AGG Exonic
901590638 1:10338798-10338820 ACCTGTCGTCAGGGAACCCCAGG + Intronic
908692271 1:66795850-66795872 ACCTGTCGTGAGGTGGAGGGAGG - Intergenic
912272789 1:108227976-108227998 CCCTGTCCTCAGGGGGAGGGAGG - Intronic
912295431 1:108466346-108466368 CCCTGTCCTCAGGGGGAGGGAGG + Intronic
912309928 1:108609897-108609919 GCCTGTCGGGAGGGGGCGGGAGG + Intronic
912487839 1:110043153-110043175 TGCTGTCCTCAGGAAGCGGGGGG - Exonic
914490318 1:148147218-148147240 ACCTGGCGGGAGGGAGTGGGTGG + Intronic
915214073 1:154328680-154328702 TCCTGCAGTCGGGGAGCGGGCGG + Intronic
915978800 1:160407741-160407763 AGGTGTCTTCAGGGAGAGGGTGG - Intronic
918241495 1:182624165-182624187 CCCTGTCCTCAGGGAGCTGGAGG - Intergenic
921056235 1:211544760-211544782 ACCTGTGGTCAGGGAACTGTGGG - Intergenic
1062888626 10:1038751-1038773 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888643 10:1038814-1038836 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888660 10:1038877-1038899 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888694 10:1039003-1039025 ACTTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888711 10:1039066-1039088 ACTTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888728 10:1039129-1039151 ACTTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888745 10:1039192-1039214 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062968840 10:1630410-1630432 GCCTGTTCTCAGGGAGGGGGCGG + Intronic
1065789647 10:29249153-29249175 TCCTGTGGGCAGAGAGCGGGAGG - Intergenic
1065866979 10:29922834-29922856 CCCTGTCTTCAGGGAGTGGTTGG - Intergenic
1068475383 10:57517411-57517433 GCCTGTCGTCGGGGGGTGGGAGG - Intergenic
1070782655 10:79146616-79146638 CCCTGTAGTCAGGGAACGGCTGG + Intronic
1074176530 10:111010524-111010546 GCCTGTCGTGGGGTAGCGGGAGG + Intronic
1076257735 10:129042032-129042054 ACCTGTCTTGAGGGAGCTGCAGG - Intergenic
1082204123 11:49410933-49410955 ACCTGTCGGCAGGGAGTTGGGGG + Intergenic
1083753119 11:64773428-64773450 ACCTGTCCTCAGGGTTAGGGGGG + Exonic
1088587241 11:111369876-111369898 ACCTGTGGTTAGGCAGCTGGAGG + Intronic
1090851435 11:130573945-130573967 ACCTGTGGACAGGGAGGTGGTGG + Intergenic
1091651015 12:2309997-2310019 ACCTGTAGTCAGAGACCTGGTGG + Intronic
1095978250 12:47954498-47954520 AGCTGTGGTCAGGAAGTGGGAGG - Intergenic
1097611736 12:61831849-61831871 GCCTGTCGTGGGGTAGCGGGAGG - Intronic
1109152067 13:58858886-58858908 ACCGGGCGCCAGGGAGCAGGGGG + Intergenic
1110475354 13:75907245-75907267 ACCTGTCAGTAGGGACCGGGTGG + Intergenic
1111943379 13:94637713-94637735 ACCTGTCGTGAGGTAGGGGGAGG - Intergenic
1113195845 13:107804516-107804538 CCCTGTCTTCAGGGAGCTTGGGG - Intronic
1120756531 14:88249821-88249843 CCCTGTCCTCAGGGAGCTTGAGG - Intronic
1121033234 14:90676900-90676922 ACCTGTCGACAGGCATCTGGAGG + Intronic
1122519169 14:102330976-102330998 ACCTGTCGGGAGGGAGGAGGAGG + Intronic
1124126093 15:26939195-26939217 AGCTGTGGTCAGGGAGTGTGAGG - Intronic
1132325870 15:100969645-100969667 ACCTGTGGTGAGGGAGGGTGGGG - Intronic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1133924794 16:10183445-10183467 ACCAGACGCCCGGGAGCGGGCGG - Intergenic
1135401757 16:22170954-22170976 ACCTGTCTTCCGGGAGAGGTGGG + Intronic
1138801019 16:60029967-60029989 ACCTGTCAGCATGGAGCTGGGGG + Intergenic
1142317822 16:89359953-89359975 ACATGTCGGCAGTGGGCGGGGGG + Intronic
1146084138 17:29812015-29812037 AACTGTTGTCAGGGAGCAAGTGG + Intronic
1152739692 17:82013493-82013515 GCCTGCCGTCAGAGAGCTGGCGG + Intronic
1158379769 18:56916266-56916288 ACCTGTCGTGGGGTGGCGGGAGG - Intronic
1160461856 18:79045299-79045321 ACCTGTGGTCGGGGAGCCGGAGG - Intergenic
1160805437 19:990446-990468 TCCTGACAGCAGGGAGCGGGAGG - Intronic
1162195452 19:8981079-8981101 CCCTGTCATCAAGGAGCGGGTGG + Exonic
1166098571 19:40557002-40557024 ACCTGCCATCAGGAAGTGGGGGG - Exonic
1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG + Exonic
1167630574 19:50623717-50623739 ACTTGTACTCAGGGAGGGGGAGG + Intronic
1168302083 19:55410879-55410901 ACTTGGGGTGAGGGAGCGGGAGG + Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
933966350 2:87432533-87432555 ACCTGTCCTGAGAGAGCTGGGGG + Intergenic
934655368 2:96114555-96114577 GCCTGTGCTCAGGGAGAGGGTGG + Exonic
936327444 2:111517952-111517974 ACCTGTCTTGAGAGAGCTGGGGG - Intergenic
939931533 2:148240259-148240281 GCCTGTCGTGAGGCAGGGGGAGG + Intronic
947611197 2:231526094-231526116 ACCTTTTGTTAGGGAGGGGGTGG - Intronic
947794630 2:232886494-232886516 GCCTGTCGGCAGGGAGGGCGAGG + Intronic
1168890072 20:1289379-1289401 ACCTGAAGTCAGGTAGAGGGGGG + Intronic
1169122806 20:3107406-3107428 CCCTGTGGTCATGGAGGGGGTGG + Intergenic
1171030179 20:21669743-21669765 AGTTGGGGTCAGGGAGCGGGTGG + Intergenic
1172623651 20:36335297-36335319 ACCTGTTGGTAGGGAGCTGGTGG + Intronic
1178081796 21:29073716-29073738 ACCTGGCGGCAGGGAAAGGGTGG - Exonic
1179181309 21:39047512-39047534 ACCTGTCTCCAGGGAGGGGAGGG - Intergenic
1181478086 22:23180802-23180824 ACCTGCCACCAGGGAGTGGGCGG + Exonic
1181511838 22:23392847-23392869 ACCTGGAGTCAGGGCTCGGGTGG + Intergenic
1184986912 22:48141927-48141949 ACATGTCAACAGGGAGCTGGTGG + Intergenic
1185239516 22:49735168-49735190 ACCAGGCTTCAGGGAGGGGGTGG + Intergenic
951534559 3:23729165-23729187 ACCTGCAGCCAGGGAGAGGGAGG + Intergenic
957143467 3:76391635-76391657 ACCTGTAGTCCGGGAGCCTGAGG - Intronic
959358157 3:105358253-105358275 CCCTGTAGTCAGGGAGCAGGAGG - Intergenic
960870828 3:122248020-122248042 ACCTGTTGTCAGGGAGATGGAGG + Intronic
966387049 3:179409935-179409957 ACGTGTTGTGAGGGAGCCGGTGG + Intronic
968659830 4:1794326-1794348 GCCTGTCGGGAGGGCGCGGGGGG + Intronic
972842532 4:42948606-42948628 ACCTTTCGGCAGGGTGCGGGTGG - Intronic
979690145 4:123550847-123550869 AGCTGGCGTGAGGGAGTGGGAGG + Intergenic
983418267 4:167485201-167485223 ACCTGGCGCCAGGGAACGGCAGG - Intergenic
986540922 5:8843049-8843071 AGCTGCCGTGAGGGAGCTGGTGG - Intergenic
993307767 5:86291985-86292007 CCCTGTCCTCAGGGGGAGGGAGG + Intergenic
993495601 5:88605399-88605421 GGCTGTCATCAGGGAGGGGGTGG - Intergenic
1002443133 5:179274620-179274642 ACCTGGGGTCAGGGAGAAGGAGG - Intronic
1015707501 6:136104046-136104068 CCCTGTCCTCAGGGAGGGTGAGG + Intronic
1020506658 7:8998416-8998438 ACATGTTGGCAGGGAGTGGGTGG + Intergenic
1027260667 7:76462221-76462243 ACCCCTCGTCAGGGAGCCGGTGG - Intronic
1027312046 7:76960334-76960356 ACCCCTCGTCAGGGAGCCGGTGG - Intergenic
1029252468 7:99246762-99246784 ACCTGTGGTGAGGGTGGGGGTGG + Intergenic
1029524302 7:101085738-101085760 ACCTGTGGCCACGGAGCGGGAGG - Intronic
1030704284 7:112675041-112675063 TCCTGTTTTCAGGGGGCGGGGGG - Intergenic
1031986196 7:128166287-128166309 ACCTGGGGTCAGGGGGCTGGGGG + Intergenic
1033595577 7:142855842-142855864 AACTGTGGTCATGGAGCTGGGGG - Intronic
1034283119 7:149867087-149867109 ATCAGTCATCAGGGAGAGGGAGG - Exonic
1034540352 7:151754463-151754485 AGCTGTGGCCAGTGAGCGGGGGG + Intronic
1037348368 8:17923360-17923382 ATCAGTCCTGAGGGAGCGGGCGG - Intronic
1041842488 8:62288390-62288412 GCCTGTCGTCAGGTAGGTGGAGG - Intronic
1042225808 8:66513519-66513541 ATCTGTCATGAGGAAGCGGGAGG - Exonic
1045412228 8:101930533-101930555 CCCTGTGGTCAAGGAGCTGGAGG - Intronic
1045844543 8:106618011-106618033 ACCAGGGGTCAGGGACCGGGCGG + Intronic
1048028433 8:130608343-130608365 TCCTGGAGTCAGGGATCGGGTGG + Intergenic
1049748084 8:144271396-144271418 ACCTGTCCCCCGGGAGCGTGGGG + Intronic
1053840423 9:42185379-42185401 AGCTGTTCCCAGGGAGCGGGAGG - Intronic
1054097476 9:60916133-60916155 AGCTGTTCCCAGGGAGCGGGAGG - Intergenic
1054118879 9:61191763-61191785 AGCTGTTCCCAGGGAGCGGGAGG - Intronic
1054588873 9:66990799-66990821 AGCTGTTCCCAGGGAGCGGGAGG + Intergenic
1055986882 9:82061961-82061983 AGCTGTTCCCAGGGAGCGGGAGG + Intergenic
1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG + Intergenic
1056584510 9:87919603-87919625 AGCTGTTCCCAGGGAGCGGGAGG - Intergenic
1056612356 9:88133317-88133339 AGCTGTTCCCAGGGAGCGGGAGG + Intergenic
1056785367 9:89588909-89588931 ACCTGGCCTCAGAGAGCAGGTGG + Intergenic
1057142713 9:92737291-92737313 TCCTATCGTCAGGGGGTGGGTGG - Intronic
1057160294 9:92884253-92884275 AGCTGTTCCCAGGGAGCGGGAGG - Intergenic
1061484497 9:130913520-130913542 CTCTGACGTCAGGGAGCTGGAGG + Intronic
1062405085 9:136392415-136392437 ACCTGTTGCCAGGGAGGGTGTGG + Intronic
1193865528 X:86726115-86726137 ACCTGCCATCAGGGAGGGTGGGG + Intronic